Transcript asmbl_75849

Sequence
Transcript Sequence for observation asmbl_75849 of TGE0007304:
AGGTTGACTTTTCACCACACTGAAACCATTAGGAAAAATCCTTGTGGTTAACAGCAGAGGCTTCAGAGTGTAACCTGTACTGGGGCCTAGAAATTATTTTAAATGGCGACTGATACGTCTCAAGGTGAACTCGTCCATCCTAAGGCACTCCCACTTATAGTAGGAGCTCAGCTGATCCACGCGGACAAGTTAGGTGAGAAGGTGGAAGAGAGCGCCATGCCGATTCGTCGAGCTGTGAATTCTACCCGGGAAACTCCTCCCAAAAACAAGCTTGCTGAAGGGGAGGAAGGAAAGCCAGAACCAGACGTAAGTTCAGAGGAATCTATCTCTACCGTAGAAGAACAAGAGAATGAAACTCCACCTGCTACATCTAGTGAGGCAGAGCAGCCAAAGGGGGAACCTGAGAATGAAGAGAAGGAAGAAAACAAGTCTTCTGAGGAAACCAAAAAGGATGAGAAAGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAAACAATACCTTCCTGGGCTACCCTTTCTGCCAGCCAGCTAGCCAGGGCCCAGAAACAAACACCGATGGCTTCCTCCCCACGTCCCAAGATGGATGCAATCCTAACGGAGGCCATTAAGGCGTGCTTCCAGAAGAGTGGTGCATCAGTTGTTGCTATTCGAAAATACATCATCCATAAGTACCCTTCTCTGGAGCTGGAGAGAAGAGGCTACCTCCTTAAACAAGCACTGAAAAGAGAATTAAATAGAGGTGTCATCAAACAGGTAAAAGGAAAAGGTGCTTCTGGGAGTTTTGTGGTGGTCCAGAAATCAAGAAAAACCCCACAGAAATCTAGAAACAGAAAGGACAGGAGCTCTGCAGTGGATCCAGAACCACAAGTAAAATTGGAAGATATCCTCCCATTGGCCTTTACTCGCCTTTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGAAAATACGTGTCTCAGTATTACCCTAAACTTAGAGTGGACATCAGGCCTCAGCTGTTGAAGAATGCTCTGCAAAGAGCAGTAGAGAGAGGCCAGTTAGAACAAATAACTGGCAAAGGAGCTTCTGGAACATTCCAGCTGAAGAAATCAGGGGAGAAACCCCTGCTTGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAATGAGCCGAAGACCTGCTCCACCACTGCTCTGAAGAAGTATGTCCTGGAGAACCACCCAGGGACCAATTCTAACTATCAAATGCATCTGCTAAAAAAAACCTTGCAGAAATGCGAAAAGAATGGGTGGATGGAACAGATCTCTGGTAAAGGATTCAGTGGCACCTTCCAGCTCTGTTTTCCCTATTACCCCAGCCCAGGAGTTCTATTTCCAAAGAAAGAGCCAGATGATTCTAAAGATGAGGATGAAGATGAAGATGACTCATCAGAAGAAGACTCTGAGGATGAAGAGCCTCCACCTAAGAGGTTACAAAAGAAAACCCCAGCCAAGTCATCAGGGAAGGCTGCATCCATGAAGCAGAGAGGGTCCAAGCCTCTACCGAAAGTCCCAGCTGCCCAGCGGGGGAAAGCTAGGCCCCTGCCCAAGAAAGCCTCTCCTAAGGCCAAAACTCCTGCCAAGAAAGCTAGACCCTCACCCTCAGTCATCAAGAAACCTAGTGGTGGCTCTTCAAAGAAGCCTGCGGCCAGTGTGAGAAAGGAAGTGAAATTGCCTGGCAAGGGCAAATCTACCATGAAGAAATCTTTCAAAGCAAAAAAGTAAATTTTATAGGGAAAAAAGGGTATCATGATGAAATTTAAAATCTTATTTTATAAGGTCAGTGTGCATTTGTTTTAGTTTTGATGCTTTTAAAATTATATTTTTTCCTTCCCCTCAGAACATTGTGAGGAGGGAATATAAATAAACCAGTTTAGGCATTCGTTAGCTTTTGGCACTATTCTTGGTGTCTGCCCCTTCCCTCGGTCATTTCATTTTCTGCGATAATTCTGGACTTGCCTGAACTGTATAATCTATACATGTCTATTTTTCTCCCTCCACCCCAACCCTCTTTTTGTTTGTTTGTTTGTTTGT