Transcript asmbl_75730

Sequence
Transcript Sequence for observation asmbl_75730 of TGE0007278:
TGGGTCTGCTGCGCGCTGCGCTGGTCGCGAACCGCGGCCCGGCTGCGGCCGGGGCTGCTGCTCTCTGCGGGCCGCTGCTCGCCTGCGGCCGCCTCCTACTCTGCTTCTGCCGAGCCCTCCCAGGTCCAGGCGCTGGTCTACGAGCACCACGGGCACCCAACCAAGGCCATCGAACTGAAGAACCTGGAGCTAACTGCTGTGGGCGGATCAGATGTCCATGTGAAGATGCTGGCGGCCCCTATCAATCCATCTGACATAAATATGATCCAAGGGAATTATGGCTTCCTTCCCAAGCTACCTGCCATTGGAGGAAACGAAGGCGTTGGACAGGTGGTCGCAGTGGGCAGCAGTGTGACTAGGGTGAAGCCAGGAGACTGGGTGATTCTAGCACATGCCGGTTTGGGAACCTGGCGGACCGAGGCTGTGTTCAGCGAGGAAGCACTGATCAGAGTTCCGAGTGACATCCCTCTTCAAACTGCTGCCACCCTGAGTGTCAATCCCTGCACAGCCTACAGGATGTTGATGGACTTTGAGCAGCTGCAGCCAGGGGATTCTGTCATCCAGAATGCATCCAACAGTGGAGTAGGGCAAGCAGTCATCCAGATCGCCGCAGCCCTGGGCCTGAGGACCATCAATGTGGTCCGAGACAGACCTGACATCCATAGGCTGACTGACAGACTGAAGAATCTAGGGGCTGAGTATGTAATCACAGAAGAAGAGCTAAGAAAACTTGAGCTGAAAAACTTCTTTAAGGATGTGCCCCGGCCCCGGCTTGCTCTCAACTGCGTCGGTGGGAAAAGCTCCACCGAGCTGCTGCAGCGCTTGGCGCCCGGAGGAACCATGGTGACCTACGGGGGCATGGCCAAGCAGCCCGTCATCGCTTCTGTGAGCGTGTTCATTTTTAAAGATGTCAAACTTCGGGGCTTTTGGCTATCCCAGTGGAAGAAGGACCACAGTACAGACCATTTTAAGGAGCTGATCCTTACACTGTGCCACCTCGTCCACCAAGGCAAGCTCACAGCCCCCACCTGCTCCGAGGTCCCACTGCAGGACTACAACCATGCCTTGGAAACCGCAATGCATCCCTTCACATCGTCAAAGCAGATTTTCATCATGTGATAATAATCCCAGAGGAGCCAGAGCAAAGTGCGGGGCAGGGGGCAG