Transcript asmbl_75575

Sequence
Transcript Sequence for observation asmbl_75575 of TGE0002492:
GGCAGCTGAGGAGACCCCGCGCAGTGCTGCCAACGCCCCGGCGGAGAAGCTGAGGTCATCATCGGATTTGAAATATTTAAAGTGGATAGAAAACTGTTTCAGCAATGCAGACAATTAAGTGCGTTGTCGTAGGCGATGGTGCCGTTGGTAAAACATGTCTCCTGATATCCTATACAACAAACAAATTTCCATCTGAGTATGTACCAACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAGCCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGCTACCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCCTCATTTGAAAATGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACCCAAATTGATCTCAGAGATGACCCTTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACGGCTGAAAAGTTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTCACACAGAAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCAGAACCGAAGAAGAGCCGCAGGTGTGTGCTGCTATGAACGTCTCTCCAGAGCCCTTTCTGCACAGCTCATGTCGGCATCATACTAAAAGCAATGTTTAAATCAAACTAAAGATTAAAAATTAAAATTCGTTTTTGCAATAATGACAAATGCCCTGCACCTACCCACATGCACTCATGTGAGACAAGGCCCATAGGTATGGCCCCTTTCCCCGTCTCAATACTAGTTAATTTTGAGTAATTGTGTATTGTCAGAAAAGTGATAAGTACTAGTTCTTGTTTTGTTGTTTCAAAAAAATTTTTTTGTTGTTTTTTTTGTTTAAAAGCAAGGCATGCTTGTGATGACTCTGTAACAGACTAATTTGGGTTGTTGAGCTGCTCCCGGGTTCCACTCCGGAGAGTGATCTGAGACATTT