Transcript asmbl_12593

Sequence
Transcript Sequence for observation asmbl_12593 of TGE0003670:
CGCCGCTCTCCCCCAGGTCCCAATGGGCCGGACCGTGGTCGTGCTGGGCGGAGGCATCAGCGGCTTGGCCGCCAGTTACTACCTGAGCCGGGCCCCCTGTCCCCCCAAGGTGGTCCTGGTGGAGGGCAGCGAGCATCTGGGAGGCTGGATCCGCTCCTTGCGCGGCCCAGACGGCGCTGTCTTTGAACTTGGACCTCGAGGAATTCGGCCAGCAGGAGCGCTGGGCGCTCGGACCCTGCTCCTGGTGTCTGAGCTCGGCCTGGACTCCGAAGTGCTGCCCGTCCGGGGGGACCACCCTGCGGCCCGGAACCGGTTCCTGTACGTGGGCGGCGCCCTGCACGCGCTGCCCTCCGGCTTCAGGGGGCTACTCCGCCCTGTGCCTCCCTTCTCCAAACCTCTGTTTTGGGCTGGGCTGAAGGAGCTGACTGCACCCCGGGGCAAAGACCCTGACGAGACTGTGCACAGTTTTGCTGAGCGCCGCCTTGGACCTGAGGTGGCGTCTCTCGCCATGGACAGCCTCTGCCGTGGAGTATTTGCAGGCGACAGCCGGGAGCTCAGCATCCGCTCTTGCTTTCCCAGTCTCTTCCAGGCGGAGCAAAGCCATGGCTCCGTGTTACTGGGGCTGCTGCTGGGGGCAGGGCGGAGCCCACAGCCCGACTCAGCCATCATTCGCCAGGCCAGAGCTGAGCGCTGGAGCCAGTGGTCACTCCGTGGAGGACTGGAGAGGTTGCCTCAGGCACTTCACAGCCACCTGACTCGTAGGGGGATCAGTGTTCTCAGAGGCCAGCCAGTCTGTGGGCTCAGCCTCCAGGCAGGAGGGCACTGGAAGGTGTCTCTAGCGGACTGCAGCCTGGAGGCTGACCATGTCGTCAGTGCTATTCCAGCTTCAGCGCTCGGCGCGCTGCTGCCTGCCGAGGCCTCACCACTGGCCGAAGTCCTGAGAACCATCCGAGCGGTGTCTGTGGCTGTGGTGAATCTGCAGTACCGCGGAGCTCGTCTGCCTGTCCAGGGGTTTGGACACTTGGTGCCGTCCTCGGAAGACCCAGGCGTCCTGGGGATCGTCTACGACTCAGTTGCTTTCCCTGAGCAGGATGGCAGCGCCCCCAGCCTCAGAGTGACTGTGATGCTGGGAGGTTCCTGGTTACAGACGCTCGAACCCGGAGGCTCCGGCCTATCCCGGGACCTGCTCCAACGCCAGGCACAGGAAGCAGCTGCCACACAATTAGGACTGAAGGGGCCACCAAGTCATTGCTTGGTTCATCTACACAGGAACTGCATCCCCCAGTATACACTAGGCCACTGGAAAAAACTGGAGTCAGCCACCCAGTTCCTGGCTGCTCACAGACTGCCCCTGACTCTGGCCGGAGCTTCCTATTGGGGGGTCGCTGTCAATGACTGTATAGAGAGTGGACGCCAGGCAGCAGCCCAGGTCCTGGGCTCAGCACCCCATAGCTGATCCCCACTCCCAGCACCTGCCTGCTGGCGGGGAGTCTCTCACCCATGACAATAAAAGTTGCTGGAGGTTG