Transcript asmbl_75367

Sequence
Transcript Sequence for observation asmbl_75367 of TGE0007233:
CGCGCTGTCGGGCGGGGGCGAGGTTCGGGCCGGTTGTGCCGTTGCGAGACTGCAGCTGCGATCGCTGCGGTGGGCCCAGAATTGTATCCTGACCGTAAATCGGAGAAGCCAGCAGCACTGCCAGTGTTCCTTTGAGGTAGTGTCTGGGATCCGGTGCAAGTTGAATCATTGTTCAAATAAGGTGTAATTGAAAAGTGACTGACCCTCTCTTCAGAGATGTCAAAAACAAACAAATCCAAGTCTGGATCTCGTTCTTCTCGCTCGAGGTCTGCATCAAGATCTCGTTCTCGTTCATTTTCGAAGTCTCGATCTCGAAGTCGATCTGTCTCTCGTTCAAGGAAGCGCAGGCTGAGTTCTAGGTCTCGTTCCAGATCATATTCTCCAGCTCATAACAGAGAGAGGAATCATCCAAGAGTATATCAGAATCGGGATTTCCGAGGGCACAACAGAGGTTATAGAAGGCCTTATTATTTCCGTGGGCGCAACAGAGGCTTTTATCCGTGGGGCCAGTATAACCGAGGAGGTTATGGAAACTACCGCTCAAATTGGCAGAATTACCGGCAAGCATACAGTCCTCGTCGGGGCCGTTCCCGATCCCGGTCCCCAAAGAGAAGGTCCCCTTCGCCACGGTCCAGGAGCCATTCTAGAAACTCCGATAAGTCTTCTTCTGACAGGTCAAGGCGCTCCTCATCCTCTCGTTCTTCCTCCAACCACAGCCGAGTTGAATCTTCTAAGCGCAAATCTGCAAAGGAGAAAAAGTCCTCTTCCAAGGATAGCCGGCCGTCTCAGGCTGCTGGGGAAAACCAGGGAGATGAAGCCAAGGAGCAGACGTTCTCTGGAGGCACTTCTCAAGATTCGAAAGCATCTGAAAGCTCTAAGCCATGGGCAGATGCCAGCACATACAGTGCTGGTTCTGCATCACGGGCCTCGGCAGTTTCCGAGCTGAGTCCCCGGGAGCGAAGCCCTGCTCTGAAAAGCCCCCTCCAGTCTGTGGTGGTGAGACGGCGGTCTCCCCGTCCCAGCCCTGTGCCCAAACCTAGCCCTCCACTTTCCAGCACATCCCAGATGGGTTCAGCTCTGCAGAGTGGTTCTGGGTACCAGGCTGGGACACACCAAGGTCAATTTGACCATGGCTCTGGGTCCTTGAGTCCATCCAAAAAGAGCCCTGTGGGTAAGAGTCCACCAGCCACTGGCTCCACATATGGCTCGTCTCAGAAAGAGGAGGCCGCTGCTCCAGGAGGAGCAGCCTATACAAAGAGGTATCTAGATGAACAGAAGACAGAGAATGGAAAAGATAAGGAACAGAAACAAACAAATACTGATAAAGAGAAAATGAAAGAGAAAGGGAGCTTCTCTGACACAGGCTTGGGTGATTCGAAAATGAAATCTGATCTGTTTGCTCCCAAAACTGATTCTGAGAAGCCTTTTCGGGGTAGCCAGTCTCCCAAAAGATATAAGCTCCGAGATGACTTTGAGAAGAAGATGGCTGACTTCCATAAGGAGGAGATGGATGATCAAGACAAGGACAAAGCTAAAGGAAGGAAGGAATCTGAGTTTGATGATGAACCCAAATTTATGTCGAAAGTCATCGCAGGTGCAAACAAAAACCAGGAGGAGGAGAAGTCAGGCAAATGGGAGGGCCTGGTATATGCACCCCCAGGGAAGGAAAAGCAGAGGAAAACGGAGGAGCTGGAGGAGGAGTCTTTCTCAGAGAGATCCAAAAAGGAAGATCGGGGAGGGCCCAAGAGAACCGAAAGTGGGCACAGGGGGTTTGTGCCTGAAAAGAATTTCCGAGTGACCGCTTACAAAGCAGCCCAGGAGAAAAGTTCATCTCCTCCCCCAAGAAAGACCTCGGAGAGCCGAGAGAAGCTGGGAGCCAAAGGAGACTTTTCCACAGGGAAGTCATCCTTTTCCATTACTCGAGAGGCCCAGGTCAATGTCCGGATGGATTCTTTTGATGAAGACCTTGCAAGACCCAGTGGGTTATTGGCCCAGGAACGCAAGCTTTGTCGGGATCTAGTCCATAGTAACAAAAAGGAACAGGAATTTCGTTCCATTTTCCAGCACATACAGTCAGCTCAGTCTCAGCGGAGCCCCTCAGAACTCTTTGCCCAGCACATAGTGACCATTGTTCACCATGTAAAAGAGCATCACTTTGGGTCCTCAGGAATGACATTGCATGAACGCTTTACTAAATACCTAAAGAGAGGAACTGAGCAGGAGGCAGCTAAAAACAAGAAAAGCCCAGAGATACACAGGAGGATAGACATTTCCCCCAGTACATTCAGAAAACATGGTTTGGCTCATGATGAAATGAAAAGCCCTCGGGAACCTGGCTACAAGGATGGGCATAATTCTAAAAATGAACTACAAAGGGTTAATTTTTATTAAATGTATCAACAACCTTTGTGAAGTGGTTAGAATATGGTAAATGACCCCAAAGTCTATTGAGGTGAGCTTGAGAAAAAAAAGAGAGGAGTTTTGGAACAAGTGCCCATGATGAGAGAAGAAACTTTTTGTGATATTTTTCTGCTTGCTGAGGGAAAATACAAAGATGATCCTGTTGATCTCCGCCTTGATATTGAACGGCGTAAAAAACATAAGGAGAGAGATCTTAAACGAGGCAAATCAAGAGAATCGGTGGATTCCAGAGACTCAAGCCACTCGAGGGAAAGATCAGCTGAGAAAACCGAGAAACCCCATAAAGGATCAAAGAAGCAGAAGAAGCACCGGAGAGCACGAGACCGGTCCAGGTCATCATCCTCTTCCTCCCAGTCATCCCACTCCTACAAAGCGGAGGAGTACACTGAAGAGACGGAGGAGAGAGAGGAGAGCACCACGGGCTTTGACAAATCGAGACTGGGGACCAAAGACTTCGTGGGTCCAAGTGAAAGAGGCAGAGCTCGAGGGGCCTTTCAATTTCGAGCCAGAGGGAGAGGCTGGGGCAGAGGCAACTACTCTGGCAACAACAACAGCAGCAGCAACAATGATTTTCAAAAGAGAAACCGGGAGGAGGAATGGGACCCTGAGTACACACCGAAAAGCAAGAAGTATTACCTGCATGACGACCGGGAAGGAGAAGGCAGTGAGAAGTGGGTGAGCCGGGGCCGTGGCCGAGGAGCCTTTCCCCGAGGTCGAGGCCGGTTCATGTTCCGGAAATCCAGCACCAGCCCTAAATGGGCCCATGACAAGTTCAGTGGGGAAGAAGGCGAGATTGAAGATGACGAGAGTGGGACAGAGAACCGAGAAGAGAAGGACAATTTACAGCCCACCACTGAGTAGGGGCCACTCTCATGAGAACCCTTGCCCAGGGGAACAGAGGCGCTGGGAAGATGGCTGGTGAAAAGCTAAACAGATGAGCCCCAAGAAGATTCTGATGAGCCCCAACCCTACCCCCCACCAGCCATGCAGAATCCTACTACAGCCAAAAGCATCCTTGGCGCTGTGTCCCACTGGACAGAGGTGGCCGGCCATGGAGCCTGGGGTCAGGCCCAGCTCTTGAGCAGAATACAACACTTTGGGCTTTAGCTGTGTTTCTCATTTGTTGTTGGTGTGTGGGGTGGGG