Transcript asmbl_12574

Sequence
Transcript Sequence for observation asmbl_12574 of TGE0003665:
AGCTGCAGAAACGGCGCGGCTGTTCCCACAAAGCGTGGCTAGCGGAGCGCCATGAGCAGAGCACCCAGCGATCTCAAGCTCAGGCTGGCCCGGGCTGGGCAGGAGCACCTGCTGCGGTTCTGGGATGAGCTGGAAGAGGCCCAGCGGGCGGAGCTCTGTGCGGAGCTCCAGGCCATGGACTTCGAGGAGCTGAGCATCTTTTTCCAGAAGGCCACCGAAGGAGTCCACCAGTTCTCTCAGCTGGAGAAGGTGGATGCGCGGATGGAGCCTATCCCTCGGGAAGTGCTGGGCAGCGCTACGCGGGATCAAGATCAGCTCCAGGCCTGGGAAAGTGAAGGACTTTTCCAGATTTCTCAGAACAAAGTGGCTGTTCTTCTTCTAGCTGGCGGACAAGGGACAAGACTTGGTGTCTCGTATCCCAAGGGGATGTACGATGTTGGGTTGCCATCTCATAAGACACTTTTTCAGATTCAAGCAGAGCGGATCCTGAAGCTTCAGCAGTTAGCTGAAAAATACCATGGCAACAAGTGCACCATCCCGTGGTATATAATGACGAGCGGCAGAACAGTGGAGTCCACAGAGGAATCCTTCACCAGACACAAGTACTTCGGTTTGAAAAAGGAGAATGTGATCTTTTTTCAGCAGGGAATGCTACCAGCCATGAGTTTTGATGGGAAAATTATTTTGGAAGAGAAGAATAAGGTTTCTATGGCTCCAGATGGAAACGGTGGTCTTTACCGGGCTCTTGCGGCCCAGAACCTCGTGGAGGATATGGAGCAGAGAGGCGTCGAGAGTGTTCACGTGTACTGCGTCGACAACATTCTGGTCAGAGTGGCGGACCCCCGGTTCATCGGATTCTGCATTCACAAGGGAGCAGACTGTGGGGCGAAGGTGGTGGAGAAGACGAACCCCACGGAGCCGGTGGGCGTGGTGTGCCGGGTGGACGGCGTGTACCGCGTGGTGGAGTACAGCGAGATCTCCCTGGCCACCGCGCAGCGGCGGGGCCCCGACGGGCGGCTGCTGTTCAGCGCGGGCAACATCGCCAACCACTTCTTCACCGTGCGGTTCCTGAGAGACGTGGTCAGTGTTTATGAACCTCAGTTGCAGCACCATGTGGCTCAAAAGAAGATTCCATTTGTGGATCCCCAGGGGCAGTTAATTAAGCCAGACAAACCAAATGGAATAAAGATGGAAAAGTTCGTCTTCGACATCTTCCAGTTTGCAAAGAAGTTCGTGGTGTATGAGGTGTTACGGGAAGACGAGTTCTCCCCACTCAAGAACGCGGACAGTCACAGTGGCAAGGACAACCCCACCACGGCCAGGCACGCTCTGCTGTCCCTTCACCACCGCTGGGTGCTCAACGCGGGGGGCCACTTCGTAGACGGAAATGGCTCCCGCCTGCCCGCGATTCCCTGCTTGAAGGATGCCCACGACGTCCCTATCCAGTGCGAGATCTCCCCTCTCGTCTCCTACGCCGGAGAGGGACTAGAAAGTTACGTGGCCGGCAAAGAATTCCACGCGCCTTTAATCATTGGCGAGAATGGCGTCTGTGAGCTGGTGAAGGACGGCGTATGAGCCAGGTGCCAAGTTCCCCGCAGCGAGAGCAGCGCTTACGTGTGACAGACCAACTGTGAGCCTCCAGGCCCCTCCTGAGGCTACTCAAGTTCGAATGTCCACGAGTCTCCTTCTGCCTGTCGAACTCTCCTAACTACTACGTAGCCCCTGAGAAGCAGCGGCCTGAACTGCAGAGAGCACCGTTAAGGTTCTCAACTCACTGACGGTCTTATTTATAGTTTTCAGTTGTATAAAATTTTCCCCAGGCCAAGGACAGCAGTGCCACCCACGCAGTTCCCTGCAGCGTGAGGGTGGCCAGGCGTGCGCCCGCCCTTCGCCTGGGGCTAGAAGCTTGTCTTCAGAGTTCTTCGGGGTGACAGTACGCCCTTGTACATGTCAGAAGGTTTCTGCGATACTACAAGTTTGTTTTATTTTATCAAAAGTAAGCTTTTTCAAGAAAATAATTGGACAGTAAAATAAACTTTTCTTTT