Transcript asmbl_74140

Sequence
Transcript Sequence for observation asmbl_74140 of TGE0007200:
CGCGTGTAGGACCCGGATGCAGACGCGAGCACAGGTTTATAAGCGCCACGCAGGCCACGGTCCCTTCTTTTGGAGGAAGACGCGGTAGCAGCTTCAGCTGCGTTTCGTCTTGCTCGCTGTTGCTCCTGACTCACCGCTGTTCGCTCTCGTGGAGGAACAAGTCGGTCAGGAAGCCGCGCTGCAGCCATGGCCTTTAAAGATACCGGAAAGACGCCCGTGGAACCAGAGGTGGCGATTCACCGAATTAGAATTACTTTGACCAGCCGCAACGTAAAATCTTTGGAGAAGGTGTGTGCTGATTTGATCAGAGGTGCGAAGGACAAGAATCTCAAAGTGAAAGGACCAGTTCGGATGCCCACCAAGACTCTGAGAATCACTACAAGAAAAACTCCCTGTGGAGAAGGTTCTAAGACTTGGGATCGTTTTCAGATGAGGATCCACAAGCGACTCATTGACTTGCACAGCCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCAGGAGTTGAGGTTGAAGTCACCATTGCAGATGCTTAAATCAGACTTTTTAATAAATTGACTATCAGTTAAATTTTGTTGACTTTTATTTGCAGTAATGGCACATTTTAAGACTATAAATTTAGACTGAATTTACTTTCAAGTAGAATAATCAAAATTAGTTGGATATGCTGTGGTAACCTGTCCTGTTTTCATTATATTCTGTTGTAGAGTCTGCTAAACCAGTTTATACTTGGAATCACAGGACAGCTGGGTTCTGTTAACTAAATACATGAGACCTGACCGTTGATGAATGTATAGTGTGGTGGCTTTATAACTGGCTGCATATTGGGGCTTTTTCAAAGAATGCATGTCTGGGTCCTATCACAAGAAATTCTGACAATTGATTTGGGGTTCTGTCCTATAACACAAACAGTTTCTGGGGTGATTCTGAAGTTCTATGACTGGTTTAGAGCCTGGCGCGTTAGAGGACAAGTAACTGGGAAAACAAGTTCTA