Transcript asmbl_74133

Sequence
Transcript Sequence for observation asmbl_74133 of TGE0007199:
GTGAGGAAGGGCCTAGGCCCAGGCCTGCTGTGCTGGGCTCGCTGAGCGCCGGAGCTCGCGTCCTGCTGTCACCTCTACCCCAGCTTCGCCCACAGCCCGTCCCAAACGGGCTGGGCGCAGGGGAGACCTGCCGGAGCCATGGAGGACGAGGTGGTCCGCATTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAACGCGGCTGGAGCACTGGATTTGCTGAAGGAGCTTAAGAATATTCCCATGACCCTGGAATTATTACAGTCTACGAGAATCGGAATGTCAGTGAATGCCATTCGCAAGCAGAGTACAGATGAAGAAGTTACATCTTTAGCAAAGTCTCTCATCAAATCCTGGAAAAAGTTATTAGATGGACCATCAACTGATAAAGATCCTGAAGAAAAGAAAAAAGATACTGCAATTACATCACAGAATAGCCCAGAGGCAAGAGAAGAAAGTAGCTCCAGTGGCAATGTAAGCAGCAGAAAGGATGAGACAAATGCTCGAGATACTTACGTGTCATCTTTCCCTCGGGCACCAAGCACATCTGATTCTGTACGGTTAAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGAGATGACTATATCGCTATCGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAGGAAGCTATATATCAAGAAATAAGGAATACAGACATGAAATACAAAAACAGAGTACGAAGTAGAATATCAAATCTTAAGGATGCAAAGAATCCAAATTTAAGGAAGAATGTACTGTGTGGGAATATTTCTCCTGACTTATTTGCTAGAATGACTGCAGAGGAAATGGCTAGTGATGAGCTCAAAGAGATGCGGAAAAACTTGACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACAGGTGGAACCCAGACTGACTTATTCACATGTGGCAAATGTAAAAAGAAGAATTGTACTTATACACAGGTACAGACCCGTAGTGCTGATGAACCGATGACAACATTCGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTCTGTTGAATTGGAAGAATTGGCAAAATGTCTGGACCATTAAGAAAATGGATTTTGTAATTAGCTTTAAAACTAGGCCAAGGAACTAGGTTTTCTGCAAGTCAGGTTTTTAAAGTGACATACACCCCTTGGTTAGTCTTTGTTTTTGACATAGCATCCTTCCTTAAATGCCTTCTGTAGTTTCAGATCAGTAGGGAGACTACATAATAATTGTATGGTATCCGTTTCAAACATTTCTTTTTCATTTTTATAGGTAATCGATATTAAACTTTTATCAATTAAACTTTTGGCAATTTATTTTTACCTTTTTTCCTTCTTAAAGGGAAATGTACCTTAACTTTTTTACAGTCTGAAACATACACAGTAGAAATGTTATTTTCACTTAACACATAAATGAAAATTACATTTTTTTTCCATATTGGCATGTACCTGCAAATGTTAACAGAGAAGAGAGGTAATATAATTTTAAGTTTATCAACTGTGGTGTGTATTCAAATAATACTTGAGCAGCTCAACTAAATTGTACATAATATTTGAAGTAGCATATGAAATTGGTTTTAATTATTATATTCACAAGTCTGGGATAATTAGATATTTTTTTTTATTTGTAACTAACCGTGACCATCATTTCTTGTAATTTCTTGTACATGTTATTACTTGTTCCTAATAGATTTTACTTTTGGAAACATGACTTGACTTTGTTGAAATCAGTTTGGGTTTGTTGTCTGTTTACCTGTTTGACTTCATAGTGGATTTTAGTTTTGCAGAACACTGTTTAGGTTAGTAGGCTTTTCATAAATCCCAGCACAGGCAGAGAATGAAAGCTCCTGGCAATTTTCTTCCCCTCATAAGAAGACATACTGGGAAGAAAACATTAGCATTTTAGTATAGTGTAATTATAAGTAGTTCATGACTTGATTTTGATTTGGAAATCTATACTGACCAAGGATCAAGTTTAAGGATTATATAAATTCTTTCCATATGGAGGTCGATAGAAAATATTTTTGTCCTAAGTCTAATTGGCTGACTTTTTCTGTTACACAGTGAATGAGGTTGTTGAACAAACTGAATATATGGCCTATAATGCAATTTGTTTTATAGTACAGATCTTACAATTAAGTTTTACTTTTTGTTTAAGTGTGTATCATTTGTTTTGTTAGGATAAGAAAAAAATGACTTTCACTTAGGTTCCTGAGGGCACACTTGCTCTAGTACATCTTAAAGGCCACTGTTACAAAGTTCACATTTTATCATGTTACATCTGTATTCTGTCAGATACCTACAGAAGGACCTAAGTACATGCTTTGCAGTCCCCTTTGTTCCCATATTCTCATTTGTTATTGGAAATAACTTGACGTAATACAGAGACGACATTTAAAGGTCCATGTTAAGACCCCACCTATAAGAATTGGCCCACTGGTATCATTCCACTTCTGCTTTGTCAGTTCACAGATTAATATTTTGTTTTATCATTTGAAAAATAAAGTACATTTTTGAAAGAATGAATTTTAAGAAGAATAAAATTAAAATTGTCCCACT