Transcript asmbl_73510

Sequence
Transcript Sequence for observation asmbl_73510 of TGE0000273:
AGGTACTAGCTTTTGACAAGTTTGCACCATGCGTGAATATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAATCTGCTCTGACTGTACAGTTTGTTCAAGGAATTTTTGTTGAAAAATATGATCCTACGATAGAAGATTCTTATAGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATTTTGGATACTGCAGGAACGGAACAATTTACAGCAATGAGGGATTTGTACATGAAAAATGGACAAGGCTTTGCGTTAGTTTATTCCATCACAGCACAGTCCACATTTAATGATTTACAAGATCTGAGAGAACAGATTCTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTGGTTGGTAATAAGTGTGACTTGGAAGATGAAAGAGTTGTAGGAAAGGAACAAGGTCAGAATCTAGCAAGACAATGGAACAACTGTGCATTCTTAGAATCCTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGACCTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCCCGCAAAAAGTCATCATGTCAGCTCCTTTAATATACTAAATGCATTGTAGCTCTGAGCCAGGTCTGAGGAATTGTTGCCCAATTCAACAGTGCCAGCATTCCAACTTTGTTAAACCTACCAACATCTTAAATGGACTTTCTGTGGTGGTACCCTTTAAGAGGCGGATGAAAGCTACTACATCAGTTTGCACATTCTAATCACTTTCCAGTATCACAAGAGAGATTTTTACTTACATAATAGTCCTAGAGTATGCAGCTGGTAAAACCAGAGGCTACAATCCAGTATTACTGCTAAGAGACATTTTTCATCCACCAATGTTGTACATGTATGAAAATGGTGTACTGTATACTTTAACACGTCCCATACTTTGTATTGGAGAGTACAATAATGTAAATCCTAAAAGCACCACTATTTTAGCATAATAAAAGAAAGTCCAAAGAGCTCCTATATAGACTACTCCAGATAACTTTGCTTCTTTGATACTTGTAGCTTATTGTAATTTTTTTTAAGAAATTCAAGGTCATTATCATTGTATTGTACAAATAAGCGCTTTGATTAACACAGCTATATAGTTTTTTTAATTTTTAAAAAACCTGTGGAGACAGTGATCTTGTCTTTAAAATATGATAGTCCTTTCAGTATAATGTCTTAGGTTAAAGACGTTGCCTTTAATATCTGTTGGGAAGGAAATGTCCAGACTTTTCAAATCTCTTATTATATGTTTCCTTTTTGTTTACATAGGGAACAATGTTTATAGTTGTGTGTACAGTGGGGGTCTACAACAAGAAGTGTATATTTTCAAACAATTTTTTAATGATTTAACAATTTTTGTAAATCATTTTCAGGCTTCTGCAGCTGTAGATTCTCACTGTGAATCCCTTGCTTGCTCATGCATAAGTGTATTTGCAATACCAAATATACAGGTTTAGTATTTTTGCCTGTTAGTGATTGTTTCACATGTGTAACGTTTTGGTTGAGATGTTAAATGGTGGACGAGTACTGTGGATGTGAATGTGGGAAGTAATTTTAATCATGTGTAATTGGTCACAAGGCCTAATTTGCAGTAACTATTGCTGTTTTATTTAACAATGCCTTGTTGCTTTGTATGCATTAACGTTTGGGTGTAAAGATTGTGTGTCTATCCAACAGGGAGCCACAGTATTTAAATTGACCAACCTAATGTTACAACTACTTTGAGGTGGCCAAATGTAAACTAAAAGCCTTAATTAAAGTGGTGCAATTTTGTATGACTTAGCATCAGTAGTTCAATAAATTTGGATTGCCATGCAAGGGCTTGCATTATAATTACTTGCCACTTGAATGTGTTTTCTGTAATGTTTAACAGTGCTAGTAAATAAATATAGGCTTAACTTTTTCAGTGTACTAGGTGCATTTTACATAGTGTGGTTTCATAATTTAACATTTGGGCAAGCCAAACTTATTAAGTACAGAAATGATGAGTGAAAGATGTCATGTTTTTATCCTAGTATTGTTTGAATATCCACATAATCACCTTTTGAGTTTTTCCTTGGCAAAGAATTTTGTAAATCAAGCAAATTACTTAAGAATATATGCCTTCTGGGTAATGTTCAGTAGCTCTGAGCATAGGAGGAGAATTAAAATACTTTGACAGATATTATGCTTATGAATTTTTAAAAGATACAGGATAAAGTTCGAATATTATGGTTACAAGCCTTTTTGAATGAGGTTGACTCAAAGTACTACTTTCTTTTTAGATAACAGATCTGCCTTTGTCTATGTGTTCTGTAATTCAGTTCTTTTTTGAAACTTGTAAACAAATCTTGACTCAAACTTTGTAAGTATTTGCCAGCCACTGGAGCATAGCAATTAATTCGTGGTAACATCTAGCTTAGGGGGCCTACTAATCCCCTAAATACATGCTATTTGAATGGGATACTTAAAGTCTTTCATTTCAAAAAGAAAAAGGTCTCCTTCCTTATGTATTTCACTCGCAGATTCATGTATTTAAAGGTTCCATGTATCTAAAAAAAAAAGGAATGTTTGTTTTCTCAGAAGTCCTACTTACCGAAGAGACTCCCTTTGGCAAAACTGGTTTTATTTAGAGCCATTGAGAGAAAATTAAACCCCCAAAAAGTGGGATTGTGGAACACTGAA