Transcript asmbl_16883

Sequence
Transcript Sequence for observation asmbl_16883 of TGE0000369:
CTGGATGTCCCCAGCTGATTTCCAGCGAGCTGTGGATGAGAGGTTTCCAGGCTGCATGCAGGGCCGCACCATGTATGTGCTTCCATTCAGCATGGGTCCTGTGGGCTCCCCGCTGTCCCGCATCGGGGTGCAGCTCACTGACTCAGCCTATGTGGTGGCAAGCATGCGTATTATGACCCGACTGGGGACACCTGTGCTTCAGGCCCTGGGAGATGGTGACTTTGTCAAGTGTCTGCACTCCGTGGGCCAGCCCCTGACAGGACAAGGGGAGCCAGTGAGCCAGTGGCCGTGCAACCCAGAGAAAACCCTGATTGGCCACGTGCCCGACCAGCGGGAGATCATCTCCTTCGGCAGCGGCTATGGTGGCAACTCCCTGCTGGGCAAGAAGTGCTTTGCCCTACGCATCGCCTCTCGGCTGGCCCGGGATGAGGGCTGGCTGGCAGAGCACATGCTGATCCTGGGCATCACCAGCCCTGCAGGGAAGAAGCGCTATGTGGCAGCCGCCTTCCCTAGTGCCTGTGGCAAGACCAACCTGGCTATGATGCGGCCTGCACTGCCAGGCTGGAAAGTGGAGTGTGTGGGGGATGATATTGCTTGGATGAGGTTTGACAGTGAAGGTCGACTCCGGGCCATCAACCCTGAGAACGGCTTCTTTGGGGTTGCCCCTGGTACCTCTGCCACCACCAATCCCAACGCCATGGCTACAATCCAGAGTAACACTATTTTTACCAATGTGGCTGAGACCAGTGATGGTGGCGTGTACTGGGAGGGCATTGACCAGCCTCTTCCACCTGGTGTTACTGTGACCTCCTGGCTGGGCAAACCCTGGAAACCTGGTGACAAGGAGCCCTGTGCACATCCCAACTCTCGATTTTGTGCCCCGGCTCGCCAGTGCCCCATCATGGACCCAGCCTGGGAGGCCCCAGAGGGTGTCCCCATTGACGCCATCATCTTTGGTGGCCGCAGACCCAAAGGGGTACCCCTGGTATACGAGGCCTTCAACTGGCGTCATGGGGTGTTTGTGGGCAGCGCCATGCGCTCTGAGTCCACTGCTGCAGCAGAACACAAAGGGAAGATCATCATGCACGACCCATTTGCCATGCGGCCCTTTTTTGGCTACAACTTCGGGCACTACCTGGAAC