Transcript asmbl_12451

Sequence
Transcript Sequence for observation asmbl_12451 of TGE0003651:
GCCGCGGCCGCTTCGATGCAAGTTGCGGTGCGCTTGCCGGGCGTCCCCGAGGAAGGCCGGAGTCACGGACGGTCCTAAGAGGGCTGCGCTCCCGGGCACCAGGCAGCGGAGGCCGGTCTGAAAAAAACATTTGAATCATGGGTGATGTTAAAAATTTTCTGTATGCCTGGTGTGGCAAAAGGAAGATGACACCAACCTATGAGATTAGAGCAGTGGGGAACAAAAACAGGCAGAAATTCATGTGTGAGGTTCGAGTGGAAGGATATAATTACATTGGCATGGGCAATTCCACCAATAAAAAAGATGCACAGAGCAATGCTGCCAGAGATTTCGTTAACTATTTGGTTCGAATAAATGAAGTAAAGAGTGAAGAAGTCCCAGCTATTGGGGTAGCACCCCCTCTGCCCCACCTTACCGATTCACCTGACACCACAGGAAATACTGGTGAAGGTTTACCAACCACCATGGGAGGACCTCTTCCTCCACATCTGGCTCTCAAGACAGAAAATAATGGCGGAGTTGGGGCCTCTGGCTATGGTGCTTCTGGGCCTACGTGGGATCGAGGAGCCAACTTGAAGGATTATTACTCAAGAAAGGAAGAACAGGAAGTACAGGCGACTCTAGAATCAGAAGAAGTGGATTTAAATGCTGGGCTTCACGGGAACTGGACCTTGGAAAATGCTAAGGCTCGTCTAAACCAATATTTCCAAAAAGAAAAGATCCAAGGAGAATATAAGTACACCCAAGTGGGTCCTGATCACAACAGGAGCTTTATTGCAGAAATGACCATTTATATCAAGCAACTGGGCAGAAGGATTTTTGCACGTGAACATGGATCAAATAAAAAACTGGCAGCACAGTCCTGTGCCCTGTCACTTGTCAGACAGCTCTACCATCTTGGAGTGATTGAAGCGTACTCTGGACTTACAAAGAAGAAAGAAGGAGAGACAGTGGAGCCTTACAAAGTCAACCTCTCTCAAGATTTAGAGCATCAGCTGCAAAACATCATTCAAGAGCTAAATCTTGAGATCATGCCCCCACCTGATGATCCTTCGGTGCCTGTTGTACTCAACCTTGGCAAATTGGCTCACTTTGAGCCATCTCAGCGACAAAGCCAAATGGGTGTGGTTCCTTGGTCACCTCCTCAATCCAACTGGAATCCTTGGACTAGCAGCAACATCGATGAGGGGCCCCTGGCTTATGCTACACCAGAACAAATAAGCAGGGATCTCAAGAATGAATTAATGTACCAGTTGGACCAGGATCATGATTTGCAAGCTATTTTGCAGGAGAGAGAGTTACTGCCTGTGAAGAAATTTGAAAGTGAAATCCTGGAAGCAATTAGTCAAAATTCAGTTGTCATTATCCGAGGTGCTACTGGATGTGGTAAAACCACACAAGTTCCTCAGTTTATCCTAGATGACTTCATCCAGAATGACCGAGCAGCAGAGTGTAATATTGTAGTTACTCAGCCCAGGAGAATCAGTGCAGTTTCTGTGGCAGAGCGCGTTGCGTATGAGAGAGGAGAAGAGCCTGGGAAAAGCTGTGGCTATAGTGTTCGGTTTGAGTCTATACTTCCCCGCCCTCATGCCAGTATAATGTTTTGTACTGTAGGTGTGCTCCTAAGAAAATTAGAAGCAGGCATTCGAGGAATCAGTCATGTAATTGTAGATGAAATACATGAAAGAGACATAAATACAGACTTCCTTTTGGTCGTGCTGCGTGATGTGGTTCAGGCTTATCCTGAAGTCCGCATTGTTCTCATGTCTGCTACTATTGATACCAGCATGTTCTGTGAATATTTCTTCAGTTGCCCCATCATCGAAGTTTATGGGAGGACTTACCCAGTTCAAGAATATTTTTTGGAAGACTGTATTCAGATGACCCACTTTGTTCCTCCACCAAAGGACAAGAAGAAGAAGGATAAGGACGATGATGGCGGTGAGGATGATGATGCAAATTGCAACCTGATCTGTGGTGATGAATACGGTCCAGAAACAAAGATGAGCATGGCTCAACTGAATGAAAAAGAAACTCCTTTTGAACTCATTGAGGCTCTGCTGAAGTACATTGAGACCCTCAATGTCCCTGGAGCCGTATTGGTCTTTTTGCCCGGTTGGAATTTGATTTACACCATGCAGAAGCATTTGGAGATGAATCCACATTTTGGAAGTCATAGGTATCAGATTCTACCTCTGCATTCTCAGATTCCTCGAGAAGAACAGCGTAAAGTATTTGATCCAGTACCGGGTGGAGTAACCAAGGTTATTTTGTCCACAAATATTGCTGAGACAAGCATTACCATAAATGATGTTGTTTATGTCATTGACTCCTGCAAGCAGAAAGTAAAGCTGTTCACTGCTCACAACAATATGACCAACTATGCTACAGTATGGGCGTCCAAAACGAACCTCGAGCAGCGGAAAGGACGAGCTGGCCGTGTACGGCCTGGGTTCTGCTTTCACCTCTGTAGCCGAGCTCGTTTTGAGAAACTCGAAACCCACATGACACCAGAGATGTTCCGGACACCGTTGCATGAAATCGCTTTGAGCATAAAACTTCTGCGTTTGGGAGGAATTGGCCAATTCTTGGCCAAGGCAATTGAACCTCCACCTTTGGATGCTGTGATTGAAGCAGAGCACACTCTTAGAGAGCTTGATGCACTGGATTCCAATGATGAGTTGACTCCTCTGGGACGAATCCTAGCTAAACTCCCCATTGAGCCTCGTCTTGGCAAAATGATGATAATGGGGTGTATTTTCTATGTGGGTGATGCTGTCTGTACCATCTCCGCTGCCACCTGCTTCCCAGAGCCTTTCATCAGTGAAGGAAAGCGACTGGGTTATATCCATCGAAATTTTGCTGGAAACAGGTTTTCTGATCACGTGGCCCTTTTATCAGTATTCCAAGCGTGGGATGATGCTAGAATGGGTGGAGAAGAAGCAGAGATACGTTTTTGTGAGCACAAAAGACTCAATATGGCTACACTGAGAATGACTTGGGAAGCCAAAGTTCAGCTCAAAGAGATTCTGATCAATTCTGGATTTCCAGAAGGTAAGACACTTATACTCTCAAGACATGTCT