Transcript asmbl_71891

Sequence
Transcript Sequence for observation asmbl_71891 of TGE0007081:
GGCGGGGCGGTATTCTACCTTGTAAATACTGTTATTTGTATATACTGTAAATGATGACATCGGTGGGCACTAACCGAGCCCGGGGAAACTGGGAACAGCCTCAAAACCAAAACCAGACACAGCACAAGCAGCGGCCACAGGCCACTGCAGAACAAATTCGACTTGCACAGATGATTTCGGACCATAACGATGCTGACTTTGAGGAAAAAGTGAAACAATTGATTGATATCACAGGCAAGAACCAGGATGAATGTGTCATTGCTTTGCATGACTGCAATGGAGATGTCAACAGAGCCATCAATGTACTGCTGGAAGGAAACCCAGATACGCATTCCTGGGAGATGGTCGGGAAGAAGAAGGGAGTTTCAGGACAGAAGGATGGTGGCCAGACGGAGTCCAACGAGGAAGGCAAAGAAAATCGAGACCGGGACAGAGACTATAGTCGGCGACGTGGTGGGCCACCAAGACGTGGGCGAGGTGCCAGCCGTGGACGAGAGTTTCGGGGTCAGGAAAATGGATTGGATGGCACCAAGAGTGGAGGGCCTTCTGGAAGAGGCACAGAAAGAGGGCGAAGAGGTCGCGGACGAGGCAGAGGTGGCTCCGGTAGGCGGGGAGGAAGGTTTTCTGCTCAAGGAATGGGAACCTTTAACCCAGCCGATTATGCAGAGCCAGCCAATACTGAAGATAACTATGGCAATAATAGCGGCAATACGTGGAACAACACTGGCCACTTCGAGCCAGATGATGGGACGAGACTTGATTTCATTGGGGTTGAGGGGTCAAATTATCCCCGAAAATTTGAGACTGCTCCTGGTGCGTGGAGGACTGCAACCGAGGAGTGGGGAACTGAAGATTGGAATGAAGATCTTTCTGAGACCAAGATCTTCACTGCCTCTAATGTGTCTTCAGTGCCTCTGCCTGCAGAGAATGTGACAATCACTGCTGGTCAGAGAATTGACCTTGCTGTTCTACTGGGGAAGACACCGTCTTCAATGGAGAATGATTCCTCTAATCTGGATCCATCTCAGGCTCCTTCTCTTGCCCAGCCTCTGGTTTTCAGTAACTCGAAGCAGAGCACCATATCACAGCCTGCTTCAGGGAGCACGTTTTCTCATCACAGTATGGTGAGCATGTTAGGGAAAGGATTTGGTGATGTCGGCGAAGCTAAAGGCGGCAGCACCACGGGCTCCCAGTTCTTGGAGCAGTTCAAGACTGCGCAGGCCCTGGCTCAGCTGGCCGCCCAGCATTCCCAGTCCGGAACCGCCACCACCTCCTCTTGGGACCTGGGCTCCACCACGCAGTCCCCTTCGCTGGTGCAGTACGATTTAAAGAACCCAAATGATTCAACAGTGCACAGCCCCTTCACAAAGCGCCAGGCTTTCACCCCATCTTCAACCATGATGGAGGTGTTCCTTCAGGAGAAGCCACCTGCAGCAGCTACCTCCACAGCTGCACCTGCACCCCCCTCTTCTCCGCTGCCAAGCAAACCTGCCTCGGCGCCACAAATGTCCCCTGGGTCTTCAGACAACCAGTCCTCCAGCCCTCAGCCGGCTCAGCAAAAACTGAAGCAGCAGAAGAAAAAAGCCTCCTTGACTTCTAAGATTCCTGCTCTGGCTGTGGAGATGCCTGGCTCGGCAGATATCTCAGGGCTAAACCTGCAGTTCGGGGCCTTGCAGTTTGGGTCGGAGCCTGTCCTTTCTGATTACGAGTCCACCCCCACCACGAGCGCCTCTTCAAGCCAGGCTCCGAGTAGCCTCTATACCAGCACGGCCAGCGAGTCTTCGTCCACAACGTCATCCAACCAGAGCCAGGAGTCCGGGTATCAGAGTGGCCCAATTCAGTCAACAACCTATACCTCCCAAAACAGTGCTCAGGGCCCTCTGTATGAACAGAGATCCACACAGACTCGGCGGTACCCCAGCTCCATCTCTTCATCACCCCAAAAGGACCTGACTCAGGCAAAGAATGGCTTCAGTTCTGTGCAGGCCACGCAGTTACAGACCACGCAATCTGTCGAAGGTGCTACAGGCTCTGCCGTGAAATCTGACTCACCTTCCACTTCTAGCATCCCCCCACTCAGCGAAACGGTCTCTGCAGCCTCCTTACTGACGACGACCAATCAGCACTCGTCCTCCCTGGGTGGCTTGAGCCACAGTGAGGAGATTCCAAATACTGCCACCACACAACACAGCAGCACGTTGTCCACGCAGCAGAACTCCCTGTCCACATCAGCATCTTCCGGGCGCACTTCGACGTCCACTCTTCTGCACACGAGCGTGGAGAGTGAGGCGAATCTCCATTCTTCCTCCAGCACTTTCTCCACCACGTCCAGCACGGTCTCTGCACCCCCCGCAGCGGTCAGCGTCTCCTCCGGTCTCAGTAGTGGCAGTAGCCTGGGCCTCAGCCTCGGCAGCAGCTCCACCGTCACGGCCTCGACACGAAGCTCAGTTGCCACGACTTCAGGAAAAGCTCCTCCTAACCTCCCGCCTGGGGTCCCGCCGTTGTTGCCTAATCCGTACATCATGGCTCCGGGGCTGTTACATGCCTACCCGCCCCAAGTGTATGGTTATGACGACTTGCAGATGCTTCAGACGAGATTTCCGTTGGATTACTACAGCATCCCGTTTCCCACGCCCACCACGCCGCTGACTGGGAGGGACGGTAGCCTGGCCAGCAACCCTTATTCCGGTGACCTCACAAAGTTCGGCCGCGGGGATGCCTCCTCCCCGGCCCCGGCCACAACCTTGGCCCAGCCCCAGCAGAACCAGACGCAGACACACCACACCACACAGCAGACGTTCCTGAACCCGGCGCTGCCTCCCGGCTACAGCTACACCAGCCTGCCGTACTACACAGGGGTGCCGGGGCTCCCCAGCACCTTCCAGTACGGGCCTGCCGTGTTCCCTGTGGCTCCTACCTCTTCTAAGCAGCATGGCGTGAACGTCAGCGTGAATGCATCGGCCACCCCCTTCCAGCAGCCAAGCGGGTACGGGTCTCACGGATACAACACTGGAAGAAAATATCCACCCCCTTACAAGCATTTCTGGACGGCAGAGAGCTAATTTGGCCCAAGGCTGGGGGCTGTGTTTTGTGTGTGTGTATGTTTGCACTGAAGTCTTGTTTCAGAAACCAGAGCACTGAGGAGAGCCTGCCGAGCTGTGGCCACGGCCTGCGTGGCTTGGGGAAATGAGTTGGTGGATGCCTTCTGGGCTCTTGAACTTGCCCGTCCCCCGCTTCCCCTCCTCCATGTGTCTGACCCTGTCTTACCCATTTCGAGTCCGAGCGGTGCAGCACCTCCGAAGCATCGATGCACACACACCCGCTGTTGCTTTTAATTTCTGGAAGGCATGTGGTTGCAACTTGTAACAAAAACCTTTGTAGTCTTCAATAAACTGTGGTGTTTCTTTAGCTAACTCTGGCGTTCTTTCCGTGCATGTCTCTCTGGACACTAGGATCCAG