Transcript asmbl_12418

Sequence
Transcript Sequence for observation asmbl_12418 of TGE0003648:
TGTGGTCCCTGGCTGAAAAGGGAGCCTGACCGAAAGCATAAAGGAACCCGAAGAAGCTCATGTAACTCTGGGAACTGTTTTAAAGAAGTTAGAGTACCAGAGAAGACCTTTGAAGTGTGAAGAGATTTCCTGTAATTGAAACCAAGATGTCATTTATAGATCCTTATCAGCACATTATAGTGGAGCATCAGTATTCCCACAAGTTCACAGTAGTGGTGTTACGTGCCACCAAAGTGACAAAGGGGGCCTTCGGTGACATGCTTGACACTCCAGACCCCTACGTGGAACTTTTCATCTCCTCAACTCCTGACAGCAGGAAGAGAACAAGACACTTTAATAATGACATAAACCCCGTGTGGAATGAGACCTTTGAATTTATTTTGGACCCAAATCAGGAAAATGTTTTGGAGATCACGTTAATGGATGCCAATTATGTCATGGATGAAACTCTGGGGACAGCAACATTTCCCATATCTTTTATGAAAGTGGGAGAGAAGAAAGAGGTTCCTTTTATTTTCAACCAAGTCACTGAAATGATCCTGGAAATGTCCCTTGAAGTTTGCTCATCCCCAGACCTCCGATTTAGCATGGCTCTGTGTGATCAGGAGAAAGCTTTCAGATACCAGAGGAAAGAAAACATAAAGGAGAACATGAAGAAACTCCTGGGTCCAAAGAACAGTGAAGGCTTGTGTTCTACACGTGATGTACCTGTGGTCGCCATACTGGGCTCAGGTGGGGGGTTTCGAGCCATGGTAGGATTCTCTGGCGTGATGAAGGCACTGTATGAATCAGGAATTTTGGATTGCACTACCTATGTTGCTGGTCTTTCTGGTTCCACATGGTACATGTCAACCTTATATTCTCACCCTGATTTTCCAGAGAAAGGGCCAGAGGAGATTAATGAAGAGCTAATGAAAAATGTTAGCTATAACCCCCTTTTACTTCTCACACCACAGAAAGTTAAAAGATATGTTGAGTCTTTATGGAAGAAGAAAAGGTCTGGACAACCTGTCACTTTTACTGATATCTTTGGGATGTTAATAGGAGAAACACTAATTCACAATAGAATGAACATTACCTTGAGTAGTTTGAAGGAAAAAGTCAATACAGCACAATGCCCGTTACCTCTTTTCACCTGTCTGCATGTCAAACCCGATGTTTCAGAACTGATGTTCGCAGATTGGGTTGAATTTAGTCCATATGAGATTGGCATGGCTAAATATGGTACTTTTATGGCTCCTGACTTATTTGGAAGCAAATTTTTTATGGGAAAAGTTGTGAAGAAATACGAAGAAAACCCCTTGCATTTCTTAATGGGTGTCTGGGGCAGCGCCTTTTCTATATTGTTCAACAGAGTCTTGGGAGTTTCCAGTTCACAAAATAAAGGTTCCACCATGGAGGAAGAATTAGAAAACATTACGGCAAAGCATATCGTGAGTAATGATAGCTCGGATAGTGATGATGAATCACAAGAACCCAAAGGCACTGAAAATGAAGATGCCGAAAGGGAATATCAAAATGATAATCAAGCAAGTTGGGTCCATCGTATGATAATGGCCTTGATGAGTGATTCAGCTCTATTCAATACCAGGGAAGGACGTGCTGGGAAGGTTCACAACTTCATGCTGGGCTTGAATCTCAATACATCTTATCCACTGTCTCCTTTCAGAGACTTCACCACACAGGACTCCTTAGATGAAGATGAACTGGATGCTGCTGTAGCAGATCCTGATGAATTTGAACAAATATATGAACCTCTGGATGTCAAAAGTAAAAAGATTCACGTAGTAGACAGTGGCCTCACATTTAACCTACCTTACCCCTTGATCCTGAGACCTCAGAGGGGAGTTGATCTCATCATCTCCTTTGACTTTTCTGCGAGGCCAAGTGACTCTAGTCCTCCGTTCAAGGAACTTCTACTTGCAGAAAAATGGGCTAAAATGAACAAGCTTCCCTTTCCAAAGATTGACCCTTATGTGTTTGATCGAGAAGGACTAAAGGAGTGTTATGTCTTTAAACCCAAGAATCCTGATGTAGAGAAAGATTGCCCAACTATCATCCACTTCGTTCTGGCCAACATCAACTTCAGAAAGTACAAGGCTCCAGGTG