Transcript asmbl_7179

Sequence
Transcript Sequence for observation asmbl_7179 of TGE0025826:
CACGCCTTAGTGCTAGCAGCGAGTCGGAGCTCTATGGAGGTGGCGGCGAGTACCGGGTGGTGGCTGCAGCAGCGACTCCTCTGAGCTGAGAGTTTCGAGCCGTTCCCGACTCCTTCCTCCCCCTTCCCTTCCCCTTTTTTGTTTTCCGTTCCCCTTCCCCTCCCTTCCCCGTCCCCGACGACCGGATCCTGAGGAGGCAGCTGCGGTGGCAGCTGCTGAGTTCTCGGTGAAGGTTTTTCATTTCTCCCATCCCCTACCCTCCCCACCCCATCCATTAATATTATTCTTTTGAAGATTCTTCGTTGTCAAGCCGCCAAAGTGGAGAGTGCGATTGCAGAAGGGGGTGCTTCTCGTTTCAGTGCTTCTTCGGGCGGAGGAGGAAGTAGGGGTGCACCTCAGCACTATCCCAAGACTGCTGGCAACAGCGAGTTCCTGGGGAAAACCCCAGGGCAAAACGCTCAGAAATGGATTCCTGCACGAAGCACTAGACGAGATGACAACTCCGCAGCAAACAACTCCGCAAATGAAAAAGAACGACATGATGCAATCTTCAGGAAAGTAAGAGGCATACTAAATAAGCTTACTCCTGAAAAGTTTGACAAGCTATGCCTTGAGCTCCTCAATGTGGGTGTAGAGTCTAAACTCATCCTTAAAGGGGTCATACTGCTGATTGTGGACAAAGCCCTAGAAGAGCCGAAGTATAGCTCACTGTATGCTCAGCTATGTCTGCGATTGGCAGAAGATGCACCAAACTTTGATGGCCCAGCAGCAGAGGGTCAACCGGGACAGAAGCAAAGCACAACATTCAGACGCCTCCTAATTTCCAAATTACAAGATGAATTTGAAAACCGAACCAGAAATGTTGATGTCTATGATAAGCGTGAAAATCCCCTCCTCCCCGAGGAGGAGGAACAGAGAGCCATTGCTAAGATCAAGATGTTGGGGAACATCAAATTCATTGGAGAACTTGGAAAGCTTGATCTTATTCATGAATCTATCCTTCATAAGTGCATCAAAACACTTTTGGAAAAGAAGAAGAGAGTCCAACTCAAAGATATGGGAGAGGATTTGGAGTGCCTCTGTCAGATAATGAGGACAGTGGGACCTAGATTAGACCATGAACGAGCCAAGTCCTTAATGGATCAATACTTTGCCCGAATGTGCTCCTTGATGTTAAGTAAGGAATTGCCAGCAAGGATTCGTTTCCTGCTGCAGGATACCGTGGAGTTGCGAGAACACCACTGGGTTCCTCGCAAGGCTTTTCTTGACAATGGACCAAAGACGATCAATCAAATCCGTCAAGATGCAGTAAAAGATCTAGGAGTGTTTATTCCAGCTCCTATGGCTCAAGGGATGAGAAGTGACTTCTTTCTGGAGGGACCGTTCATGCCACCCAGGATGAAAATGGATAGGGACCCACTTGGAGGACTTGCTGATATGTTTGGACAAATGCCAGGTAGCGGAATTGGTACTGGTCCAGGAGTTATCCAGGATAGATTTTCACCCACCATGGGGCGTCATCGTTCAAATCAACTCTTCAATGGCCATGGGGGACACATAATGCCTCCCACACAATCGCAGTTTGGAGAGATGGGAGGCAAGTTTATGAAAAGCCAGGGGCTAAGCCAGCTCTACCATAACCAGAGTCAGGGACTCTTATCCCAGCTGCAAGGACAGTCGAAGGATATGCCACCTCGGTTTTCTAAGAAAGGACAGCTTAATGCAGATGAGATTAGCCTGAGGCCTGCTCAGTCGTTCCTAATGAATAAAAATCAAGTGCCAAAGCTTCAGCCTCAGATAACTATGATTCCTCCTAGTGCACAACCACCACGCACTCAAACACCACCTCTGGGACAGACACCTCAGCTTGGTCTCAAAACTAACCCACCACTTATTCAGGAAAAGCCTGCCAAGACCAGTAAAAAGCCACCCCCATCAAAGGAAGAACTACTTAAACTAACTGAAACCGTTGTGACTGAATATCTCAATAGTGGAAATGCGAATGAAGCTGTTAACGGCGTGAGAGAAATGAGGGCTCCTAAACACTTTCTTCCTGAGATGTTAAGCAAAGTAATCATCTTGTCACTAGACAGAAGTGATGAAGATAAAGAAAAAGCAAGTTCTTTGATCAGTTTACTCAAACAGGAAGGGATAGCCACAAGTGACAACTTCATGCAGGCTTTCCTGAACGTACTGGACCAGTGCCCCAAACTGGAGGTTGACATCCCCTTGGTGAAATCATATTTAGCACAGTTTGCAGCTCGTGCCATCATTTCAGAGCTGGTGAGCATTTCAGAACTAGCTCAACCACTGGAAAGTGGCACCCATTTTCCTCTCTTCTTACTTTGTCTTCAGCAATTAGCTAAATTACAAGATCGAGAATGGTTAACAGAACTTTTTCAACAAAGCAAGGTCAATATGCAGAAAATGCTCCCAGGTAAGAGAATACTGGGTTTTTTTTTGTTGTTTTTTAATGCTAAGTCTAGATTTCTTGGTACTTTGAATGGATTTATGTAGGTCAGACAGTGTTATCTTCCTGACAAACTAATGATAAGCATTTATAAAGACTACCTTAATAAAAAGTTATGATTTTTAACTACTTTTATTTGCTCCACATGTTGAGAGTTTCCTTTGCTGGGTTAGTTCTTTATTCTTTTACATGAATGTTGTACATTTGGGAACTCACTGCCTG