Transcript asmbl_7151

Sequence
Transcript Sequence for observation asmbl_7151 of TGE0006793:
AGCGCGACGACGGCGGCGGCGGCGGTGGTGGGTCCATCGCTGGACGGCTAAGGGGAAAGCCAGGCCTGAGCTTCTGCATCTAGGATCAGAATGGTTTCAATCCCAGAATACTATGAAGGCAAGAATGTTCTTCTCACTGGAGCTACTGGTTTCCTAGGGAAGGTACTTCTGGAAAAGTTGCTGAGGTCTTGTCCTAAAGTGAATTTAGTGTATGTTCTGGTGAGGCAGAAAGCTGGACAGACACCCCAAGAGCGAGTAGAAGAAGTCATTAGTGGCAAGCTCTTTGACAGATTGAGAGATGAAAATCCAGATTTTAGGGAGAAAATTATAGCAATCAGCAGTGAACTTACCCAACCTATACTGGCTCTTAGTGAAGAAGATAAAGAGATCATCATAGATTCTACCAATATTATATTCCACTGTGCAGCTACAGTAAGGTTTAATGAAAATTTAAGAGATGCTGTTCAGTTAAACGTGATTGCCACACGACAGCTTATTCTCCTTGCACAACAAATGAAGAACCTGGAAGTGTTCACACATGTGTCAACAGCATACGCCTACTGCAATCGAAAGCATATTGATGAAGTAGTCTATCCACCCCCTGTAGATCCCAAGAAACTGATAGATTCTTTAGAGTGGATGGATGATGGCCTAGTAAATGATATCACCCCCAAATTGATAGGAGACAGACCTAATACGTACATATACACAAAAGCATTGGCAGAGTATGTTGTACAACAAGAAGGAGCAAAGCTAAATGTGGCAATTGTAAGGCCATCAATCGTTGGTGCCAGTTGGAAAGAACCTTTTCCAGGATGGATTGATAACTTTAATGGACCAAGTGGTCTCTTTATTGCGGCAGGGAAAGGAATTCTTCGAACAATGCGTGCCTCCAACAGTGCCCTTGCAGATCTCGTTCCTGTAGATGTAGTTGTCAACATGAGTCTTGCGGCAGCCTGGTATTCCGGAATTAATAGACCAAAGAACATCATGGTGTATAATTGCACAACAGGCAGCACTAATCCTTTCCATTGGGGTGAAGTTGAATACCATGTAATTTCCACTTTCAAGAGGAATCCTCTCGAACAGGCCTTCAGACGGCCCAATGTAAATCTAACCTCCAATCACCTTTTATATCAGTACTGGATTGCTGTAAGCCATAAGGCGCCAGCATTCCTGTATGATATCTACCTCAGGATGACTGGAAGAAGCCCAAGGATGATGAAAACAATAACTCGTCTTCACAAAGCTATGGTGTTTCTTGAATATTTCACAAGTAATTCTTGGGTTTGGAATACTGACAATGTCAATATGTTAATGAATCAACTAAACCCTGAAGATAAAAAGACTTTTAATATTGATGTGCGGCAGTTACATTGGGCAGAGTACATAGAGAACTACTGCATGGGGACTAAGAAATATGTTTTGAATGAAGAAATGTCTGGCCTCCCTGCAGCTAGAAAACATCTGAACAAGTTGAGGAACATACGTTACGGTTTCAATACTATCCTTGTGATCCTGATCTGGCGTATTTTTATTGCAAGATCACAAATGGCAAGAAACATCTGGTACTTTGTGGTTAGTCTGTGTTACAAGTTTCTGTCATACTTCCGAGCATCCAGCACTATGAGATACTGAAGACAAGAATTTAGCATTAGAACATCTATGCATATGGTGGTCTAAATGCACAAAACGTAAAATGTACTTAAGTCATGTCATCTTTTGTCAAGACATTAAACCATCTTAGATCAGAGAGTGGAGTAAATTATGGTACATTTTATGTAACGTTTTAATGTTTATGCTCTTAAAAATCTAGTGAACACACTGTGGTATGCCATCTCAATTCTGCAATAGCCACCAAAACCATGACTTAATATTTTGATCCCTCGGGAAAAGGGGTGGGGTGAGGGTAGGAGTGGGGATATAGGAACACTGACCAGTATAACTGTGCAATTCTGGAACATATTAATTAAAATATGCCTTAACATATAGTGAATTTCTAATTCTAATATTGAATGCAATGGAAAGCATTTATTTGGACAGGAATACGAGCTAAGTTGGTAGATATTTGATTCTTCAGTGTTTAATTTTTTTCATCAGTCGATGTGGGTTTTAGTTTTGTTCAAGTTATAGCCAAACTATTTTCACATCATCCTGTAAGTTATCGAGTGGTCTCAGACATGAAAGATGTGTTCTCATTTTTCTTTCTCTGATTAGAGGTCTCATGCATATCATTTTTCTATAAGCAATCAGTTGCTTTCATAATCAGAAGGCTATAATTATTCTAAAGATCCTAATAGATCGAAATGGGCTTGAAAATCCATATCAACATATGCTATGTGTTTTTTGAAGGAAAATTAAAATGAATTCAGTAAGACTTGGCATCAAAAATTAGGATACATTTTTTTGTTCACATTATGGCAAATAAAAATCCTGTGAGATGTTGTTCATGTTTTTAAGATGGAGGATTTCTTGAGACTTTGGCAAATGGGG