Transcript asmbl_12406

Sequence
Transcript Sequence for observation asmbl_12406 of TGE0003645:
GAAAAATCCGCGAGAAGGTGGTGGAAGAAGATGGCGGTGCTAGGGCCGAGTTTACAATCTTTTTGAATAGACTAGTCCAGTAACTGTTCGGGTCATGGCGTCAAACTCAACTAAGTCTTTCCTGGCAGATGCAGGCTATGGAGAACAGGAGCTGGATGCTAACTCTGCCCTTATGGAATTAGACAAAGGTCTGAGATCTGGCAAACTTGGTGAACAGTGTGAAGCAGTTGTTCGCTTTCCCAGGCTCTTTCAGAAGTATCCATTCCCTATTCTCATCAATTCTGCATTCCTAAAGTTAGCTGATGTTTTCAGAGTTGGAAACAATTTCCTGAGGCTCTGTGTTCTTAAAGTTACTCAACAAAGTGAGAAGCATTTGGAGAAAATTCTAAATGTGGATGAATTTGTGAAGAGAATTTTCTCTGTGATTCATAGTAATGATCCTGTAGCAAGAGCCATCACACTCCGCATGTTGGGAAGTCTGGCATCAATAATTCCTGAAAGGAAGAATGCTCACCATAGTATTCGTCAGAGTCTGGATTCACATGATAACGTAGAAGTTGAAGCTGCTGTTTTTGCTGCTGCAAACTTCTCTGCACAGTCAAAGGATTTTGCTGTAGGAATCTGTAACAAAATCAGTGAAATGATTCAAGGCTTAGCCACACCAGTAGACTTGAAGCTAAAGTTGATCCCAATCCTACAGCACATGCACCACGATGCGATCCTGGCTTCCAGCGCTCGTCAGCTGTTACAACAGCTAGTCACGTCCTATCCTTCTACCAAAATGGTGATTGTTTCTTTGCACACTTTTACTCTGCTTGCAGCTTCATCTTTGGTGGATACACCTAAGCAGATTCAGCTTCTCTTACAGTATTTGAAGACTGACCCCAGGAAAGCAGTAAAGAGACTTGCTATTCAAGATCTGAAATTACTTGCCAATAAAACACCGCATACTTGGACTAGGGAAAACATTCAGGCACTCTGTGAATGTGCCCTCCAGACTCCTTATGACAGCTTAAAACTCGGGATGTTGTCTGTCCTTTCCACACTGTCAGGGACTATCGCTGTCAAACATTACTTCAGCATAGCTTCGGGAAATGTGGGTTCTTCGCCTAGATCCTCTGATTTAGTCAAATTAGCCCAAGAGTGCTGTTACCATAATAACAGGGGCATTGCAGCTCATGGAGTCAGAGTACTAACTAATATAACTGTTTCTTGTCAAGAAAAAGACCTTTTGGCACTGGAACAAGATGCTGTTTTTGGCCTGGAAGCCCTTCTGATACTTTGTAGTCAAGACGATAGTCCAGGTGCTCAAGCCACTTTAAAGATTGCTCTGAACTGTATGGTGAAGCTGGCCAAGGGCAGACCCCATCTTAGCCAGTCAGTGGTTGAGACCTTGTTGACTCAGTTGCACAGTGCTCAGGATGCTGCCCGGATCCTGATGTGCCATTGCCTGGCTGCCATTGCCATGCAGCTGCCGGTGCTGGGTGATGGAATGCTGGGTGACCTCGTGGAACTCTACAAGGTGATTGGACGATCAGCCACAGACAAGCAGCAGGAACTTCTGGTGAGTTTGGCCACTGTGATTTTTGTCGCCAGTCAGAAAGCACTCTCTCCTGAGGTAAAGGCAGTAATTAAACAGCAGCTCGAAAGTGTCTCCAATGGGTGGACTGTGTACCGAATCGCCAGACAGGCATCCAGAATGGGTAATCATGACATGGCCAAAGAGCTTTATCAGAGTTTGCTGACTCAGGTTGCCTCAGAACATTTCTACTTCTGGCTGAATAGTTTGAAGGAGTTCTCACATGCAGAACAGTGTCTCACTGGATTGCAAAAGGAAAATTATAGTTCAGCACTTTCTTGCATTGCTGAGTCTTTAAAATTCTACCACAAAGGGATTGCATCCCTAACGGCTGCCAGTACACCACTGAATCCTTTAAGTTTTCAGTGTGAATTTGTAAAACTCAGGATTGACCTTCTACAAGCCTTCTCGCAACTTATCTGTACTTGTAATAGCCTAAAGACAAGCCCCCCACCTGCAATTGCCACAACAATTGCCATGACCTTAGGGAATGACCTTCAGAGGTGTGGTCGCATCTCCAATCAGATGAAACAGTCCATGGAAGAATTCCGAAGCCTTGCTTCCCGATATGGAGATCTTTATCAGGCATCTTTTGATGCCGATTCAGCAACTTTGAGAAATGTAGAGCTACAGCAGCAGAGCTGTTTGCTGATATCTCACGCAATAGAAGCTCTGATTTTGGACCCGGAATCTGCAAGTTTCCAGGAATATGGATCTACTGGAACAGCCCATGCTGATAGTGAATATGAGAGAAGAATGATGTCTGTGTATAATCATGTCTTGGAGGAGGTGGAATCACTCAATCGGAAATATACCCCTGTTTCTTATATGCATACAGCATGCCTCTGCAATGCCATCATTGCTTTGCTGAAAGTTCCTCTTTCATTTCAGAGATATTTTTTCCAGAAACTGCAGTCTACCAGCATTAAGCTTGCTCTGTCACCATCCCCACGGAACCCTGCAGAGCCCATCGCTGTCCAAAATAACCAGCAGCTGGCGCTGAAGGTGGAGGGAGTGGTTCAGCATGGATCCAAACCAGGACTTTTTCGCAAAATTCAGTCTGTCTGTCTGAATGTTTCTTCCACGCTACAGAGTAAATCTGGACAAGACTACAAGATACCCATCGACAATATGACCAATGAGATGGAGCAGAGGGTTGAGCCTCATAATGATTACTTTAGTACTCAGTTTCTGTTGAACTTTGCTATCCTTGGAACACACAATATTACAGTGGAATCTTCAGTGAAAGACGCCAATGGTATTGTATGGAAGACTGGTCCCAGAACTACCATATTTGTCAAATCCCTGGAAGACCCTTATTCCCAGCAAATCCGCCTACAACAGCAGCAAGCCCAGCAGCCATTACAACAGCAGCAGCAACGGAATGCCTACACGCGATTTTAGCCACGTGACGAGTGTACTACAGGCTTTACAGGAATCGATGAAATTGTCAAAAATAGTTTGCTTTTCCACATGGATTAAGATATGAAAGTTTTAACGCAGACTCTGTTTACTCATTGGTTTCTGCAATGTAATCTGAAAAATGATTTTTTTTACCTTAAAAATTTCATTCGAGAGATATTTGGGTTACTAACCAGAAAGATTTTTTTCCCTTGTTCCTTTAACCAAGTCCTTTATCTCATATTTAACATTTTCATTCTTTTATTAGTGTTTTTACTGCTGCTGAGCCTTTTCTTTTTCTTTCAAGAAAAGTCACATATTGGGATCACTGAATTAGTAAATTTGACTGTTTCTCTACCAAAATATACTACTTGCTGCTTGACACAGGCCTGTAATTCTGAGCTATGCCTTGGGGAGTTCTGACCAGTAGGGTACAGGGTTCACCCGTAGTAGAAGAAACTGAGTCTTCCCGTGGGTGGACTTAGAAATGTCCCCTGAAACGTCCAGTTTCTGGGTTACGAGAGCAGGCAGTCTAGCAGAATTGAGACATCCTGCTATACATATTATTTCAACTACTTACCTATCTGTTCTGTGCTAAAGCAATCTTAATTTATTGTTTTAGTATTTAATTGACCCAAAGAGCAGCTAGCAATTACATAGGAAGATTTGGAGATTAATAATTTTTTTTTTATTATGCGTGTGATTGTGTAGACTTTGTACATTGTTTCTAAGAGTGAAAAAAATCACTCACATTTAATATCTTATTGTTTTAAGGTAGGAGGGCAGATCTTTTCCTTTGATTGATTTAGTTTCTTCTTGGCAAGTTCTGTAACGCTAGACTTGATTGTCTAGAAAGGACCGTCTCCTTATAACCAACCTCAATTAGTTGAGATGCTCAGGGAATAGAAGTTTTCTGGTTAGCCAGAAAACTCCTTTTTTCTATTTCAATACTGGCTGAAAACCATTGTAAAATCTAATAATAGTATGCTTTCTTGTCTTAACACAGTGCAGTAGATAAAATTTAACTATTCTTTCTTGATTTGGGATCAGTCAGTGCTTTGGGATCATGATTTCTAAACATCAGGGATCACAGATTGCAGATATCGATGATATGGTCACTTAGGCTGGAATCAGCTCTGAATGTGAAGCAGACACATTCCTTGGAAGTT