Transcript asmbl_12146

Sequence
Transcript Sequence for observation asmbl_12146 of TGE0003635:
CTTACCCGTGTTTACTTATAGTTAAATGTAATCAGGATCGATGTAATCGTTTGAGTTGCAGCTAACTTTTTAAAAAAAATAACTTTTATTTTTAGTAAAATGTTTATTGGAGGCTTGAGCTGGGATACAAGCAAGAAAGATCTGACTGAATATTTGTCTCGGTTTGGGGAAGTTGTAGACTGCACAATTAAAACAGATCCAGTCACCGGAAGATCAAGAGGATTTGGATTTGTGCTTTTCAAAGATGCTGCTAGTGTTGATAAGGTTTTGGAATTGAAGGAACACAAACTGGATGGCAAATTGATAGACCCCAAAAGGGCCAAAGCTTTAAAGGGGAAGGAACCCCCAAAAAAGGTTTTTGTGGGTGGATTGAGCCCAGATACTTCTGAAGAACAAATTAAAGAATATTTTGGAGCCTTTGGAGAGATTGAAAATATTGAACTTCCCATGGATACAAAAACAAATGAAAGAAGAGGATTTTGTTTTATCACATACACAGATGAAGAGCCAGTAAAGAAATTATTAGAAAGCAGATATCATCAAATTGGTTCGGGGAAGTGTGAAATCAAAGTTGCACAGCCCAAAGAGGTATATAGGCAGCAACAGCAACAACAAAAAGGAGGAAGAGGTGCTGCAGCTGGTGGACGAGGTGGTACTAGGGGTCGAGGCCGAGGTCAGGGCCAAAACTGGAACCAAGGATTTAATAACTATTATGATCAAGGATATGGAAATTACAATAGTGCCTATGGTGGTGATCAAAACTATAGTGGCTATGGCGGCTATGATTATACTGGGTATAACTATGGGAACTATGGATATGGACAGGGATATACAGACTACAGTGGCCAACAGAGCACTTATGGCAAGGCGTCTCGAGGGGGTGGCAATCATCAAAACAATTATCAACCATACTAAAGGAGGACATGGGGGAGAAAACAGCGGGAACTTCATTGCAGGCCGTGTGTCACCCTGACCACGTCTATCTCTGGGGGTCGCACGTTGCGGGCAGAGCGCAAGGCATACACCAGAAAACGCTGTCCTGTGGTATGGTCTCTTCCAACTTCATGTACCAGCGTAAAGATTAAAGTGGAAAACTTCAGACTTTGGCTTCTTTTTTAATCTTTTTTGAAGATTAAGTGTCTAAACTTAACTTAAATGGTTTTTTACAGGAGTTAAAGTACATAAATGCCTTTTTACAGCTTAATCATTTTGGTCTTCTGTTTAGTGTTGTATTTCAATTGTGGAGCCTCATTTTAAGTGTTCATTCTTTAAGATTTAATGCTTGCTTTTTCTTTTTATAGCTAATAGTGAAATCTACAAACCAAAACAAGAACTTTAAAATCTGGGACAAAAATTAAAGATCATATGCACAGAGCAATTTGTTTTCTTGAACTATAATAAGCCATTATAAATTCATGTTTGTAAAAGCATTTTGCTTGGTTTACTAGAGATGCTTATTGTAGACCTTAATCTAGCCACAGTTCAACGGGAAGATTCAATTCCCAGATTCTTTTCTATCATTTGGGAACTCCAGGGTGAATTTATTGGTTACCCAAACTTCATTTTGCCAATGGATATGCATGTGATCTTTAATTATTGAAGAAAAGAATAAATTGAGGACTTAAAACAATTCATGAAAGTGGACCTTTGAAAGCTTGTCAGAGTTGTACAAATCTAATTGCTATTTTGTTTTTGTTTTTAGGAGGAAATTGCTAAAGTAACCCATCTTGCAGGACAACGTTGAAGATTGATCTTCTGTTGATCTAAGATGATAATTTTGTAAAAGACTTTCTAGTGTACAAGACACAACTGTGTCCAACTGTATATAGCCGCCAATTAGTTTTCTTTGTTTTTACTTTGTCTTTTGCTATCTGTGTTATGACTCAATGTGGATTTGTGTTTATACAAATTTTATTTGTATGATTTCATGTTAAACCTCAAATAAATGCTTCCTTATGTAATTGTTTTTCTGCGTCAGGTACTAAATAGCTCTGTAAAAGTGTAATTTTAAATAAGCAATAATTAAGGCACAGTTTATTTTGTAAGGGGTATTGGTCTGTAGGGAGAAACTGGTCCTTGTGAATAGCCAGCTTTACAGTGTCACCCTGTTCCCCATTTTTGTTAGATGTATTCTATGCTTTCAGTTTTCATTTCCCTGTTAACTGAGGCTTTCACCATACTTAAAATGTGCTTTCCTCTCTGTATATCTGGAGTCTTTGTCATGAAAGTCTCCATGTTATAGTGTCGTGATAGTGGAAGCTTTCTAGTAGGCCATGAGTCTTCTGAATTACATTCTGAAGAAAAACCCCCATTTAATGGCACAAAGCTTGTTGGTAGCTCCTTTTATTGAACAGAAAGATTCTGCTTTGTTTTGGTCTTTGGGAAGCCATTTGTTATGATTTGGTAAATACTGCTTACTGGTAGGCTAAAAACACCTTTGTGTAATCATAATACCATGATTTTAACTCTAGATTAGAATGTCCAGATATACCCAGGGAAAAGGCCTTGTTAAACTTGTAGGAGCTACAGTTTGAAAGTATCAAAAATAGTTATTACAAGGATTTTGGCAGGTGGGTATGAGTTATTAGATTCAGATATTTGAGGTACTGGCTAAGTAAATTTGTTGTATTCTTGGTATGGCACAGCAAGCACCAAATTCAATAGTGTTTTCTTTTGGGGTGTTCTTAGGAAGCTATATTGGATATTAACTGTTATGTGGTGTGAGCTTTTAGAAAAAGCCATAGTAGATTTCATCATTATTAATGCAGTTAGTGCATGAGCCGAGTAGCTAAGCATATCCATAATCAGACATAGGAGTAGTAGGAAAAGATATGCTTTAAATCTTACATATGTTAATGCAAATCTAGATGTGACCAAGTCCTGTCATTACAGCAATTCTTCCTGGTGCATTAAAAAGCAGTTTTAGCTCTAGATTTTGGAGGATTTCCTGGGTAAATCCAAGCTTTGAATTTTCTATTCAGTATAGTTAACTGGATTTAATAAGGTTTTTAAGTTTTGTCTCTGGTTTTTTTTTAGCCATTAAGGATTGGCGTACATGTTCATATGTGGAATAGTTGATCTGCACTTTTCAACCGAGTGTAAACTTATGCTGATGAACCTGCC