Transcript asmbl_12145

Sequence
Transcript Sequence for observation asmbl_12145 of TGE0003635:
CTTACCCGTGTTTACTTATAGTTAAATGTAATCAGGATCGATGTAATCGTTTGAGTTGCAGCTAACTTTTTAAAAAAAATAACTTTTATTTTTAGTAAAATGTTTATTGGAGGCTTGAGCTGGGATACAAGCAAGAAAGATCTGACTGAATATTTGTCTCGGTTTGGGGAAGTTGTAGACTGCACAATTAAAACAGATCCAGTCACCGGAAGATCAAGAGGATTTGGATTTGTGCTTTTCAAAGATGCTGCTAGTGTTGATAAGGTTTTGGAATTGAAGGAACACAAACTGGATGGCAAATTGATAGACCCCAAAAGGGCCAAAGCTTTAAAGGGGAAGGAACCCCCAAAAAAGGTTTTTGTGGGTGGATTGAGCCCAGATACTTCTGAAGAACAAATTAAAGAATATTTTGGAGCCTTTGGAGAGATTGAAAATATTGAACTTCCCATGGATACAAAAACAAATGAAAGAAGAGGATTTTGTTTTATCACATACACAGATGAAGAGCCAGTAAAGAAATTATTAGAAAGCAGATATCATCAAATTGGTTCGGGGAAGTGTGAAATCAAAGTTGCACAGCCCAAAGAGGTATATAGGCAGCAACAGCAACAACAAAAAGGAGGAAGAGGTGCTGCAGCTGGTGGACGAGGTGGTACTAGGGGTCGAGGCCGAGGTCAGGGCCAAAACTGGAACCAAGGATTTAATAACTATTATGATCAAGGATATGGAAATTACAATAGTGCCTATGGTGGTGATCAAAACTATAGTGGCTATGGCGGCTATGATTATACTGGGTATAACTATGGGAACTATGGATATGGACAGGGATATACAGACTACAGTGGCCAACAGAGCACTTATGGCAAGGCGTCTCGAGGGGGTGGCAATCATCAAAACAATTATCAACCATACTAAAGGAGGACATGGGGGAGAAAACAGGAGGAAATTGCTAAAGTAACCCATCTTGCAGGACAACGTTGAAGATTGATCTTCTGTTGATCTAAGATGATAATTTTGTAAAAGACTTTCTAGTGTACAAGACACAACTGTGTCCAACTGTATATAGCCGCCAATTAGTTTTCTTTGTTTTTACTTTGTCTTTTGCTATCTGTGTTATGACTCAATGTGGATTTGTGTTTATACAAATTTTATTTGTATGATTTCATGTTAAACCTCAAATAAATGCTTCCTTATGTAATTGTTTTTCTGCGTCAGGTACTAAATAGCTCTGTAAAAGTGTAATTTTAAATAAGCAATAATTAAGGCACAGTTTATTTTGTAAGGGGTATTGGTCTGTAGGGAGAAACTGGTCCTTGTGAATAGCCAGCTTTACAGTGTCACCCTGTTCCCCATTTTTGTTAGATGTATTCTATGCTTTCAGTTTTCATTTCCCTGTTAACTGAGGCTTTCACCATACTTAAAATGTGCTTTCCTCTCTGTATATCTGGAGTCTTTGTCATGAAAGTCTCCATGTTATAGTGTCGTGATAGTGGAAGCTTTCTAGTAGGCCATGAGTCTTCTGAATTACATTCTGAAGAAAAACCCCCATTTAATGGCACAAAGCTTGTTGGTAGCTCCTTTTATTGAACAGAAAGATTCTGCTTTGTTTTGGTCTTTGGGAAGCCATTTGTTATGATTTGGTAAATACTGCTTACTGGTAGGCTAAAAACACCTTTGTGTAATCATAATACCATGATTTTAACTCTAGATTAGAATGTCCAGATATACCCAGGGAAAAGGCCTTGTTAAACTTGTAGGAGCTACAGTTTGAAAGTATCAAAAATAGTTATTACAAGGATTTTGGCAGGTGGGTATGAGTTATTAGATTCAGATATTTGAGGTACTGGCTAAGTAAATTTGTTGTATTCTTGGTATGGCACAGCAAGCACCAAATTCAATAGTGTTTTCTTTTGGGGTGTTCTTAGGAAGCTATATTGGATATTAACTGTTATGTGGTGTGAGCTTTTAGAAAAAGCCATAGTAGATTTCATCATTATTAATGCAGTTAGTGCATGAGCCGAGTAGCTAAGCATATCCATAATCAGACATAGGAGTAGTAGGAAAAGATATGCTTTAAATCTTACATATGTTAATGCAAATCTAGATGTGACCAAGTCCTGTCATTACAGCAATTCTTCCTGGTGCATTAAAAAGCAGTTTTAGCTCTAGATTTTGGAGGATTTCCTGGGTAAATCCAAGCTTTGAATTTTCTATTCAGTATAGTTAACTGGATTTAATAAGGTTTTTAAGTTTTGTCTCTGGTTTTTTTTTAGCCATTAAGGATTGGCGTACATGTTCATATGTGGAATAGTTGATCTGCACTTTTCAACCGAGTGTAAACTTATGCTGATGAACCTGCC