Transcript asmbl_70140

Sequence
Transcript Sequence for observation asmbl_70140 of TGE0025753:
GAAGCTGGATCAATTGCCTCATTAAGCGTGAAGCTTGTGCTTCTGGGTCTTGGGAGGCCTAGCTTCCTCGAAAGACTGTATCCACTACTTTGAGGAGGAGATCGCCGAGGTCATTGCCGTGGTTTGCACAGTTGGCTGGCCGGCGCTATGGTGGAAAGAAGAGGAACAGCCAAAGTGGACTTTTTTAAGAAGATTGAGAAAGAAATCCAACAGAAATGGGATACCGAGAAAGTGTTTGAGGTCAATGCATCTAATTTAGAGAAGCAGAGTAGCAAGGGCAAGTACTTTGTAACCTTCCCATATCCATACATGAATGGGCGTCTTCATTTGGGTCACACATTCTCTTTAGCCAAATGTGAGTTTGCACTCGGGTACCAGAGGTTGAAAGGAAAAATTTGTCTGTTTCCCTTTGGTTTACACTGTACTGGAATGCCTATTAAGGCATGTGCCGATAAGTTGAAAAGAGAAATAGAGCTGTATGGTTGCCCCCCTGATTTTCCAGATGAAGAAGAGGAAGAGGAAGATGTTAAAATAGAAGATATAAAAATTAAGGATAAATCTAAAGGAAAAAAGAGTAAAGCTGCTGCTAAAGCCGGATCTTCTAAATACCAGTGGAACATTATGAAATCCCTTGGTCTGGATGATGAAGAGATAGCCAAATTTTCTGAAGCTGAATATTGGCTTGATTATTTCCCACCCCTGGCTATTCAGGATCTAAAGAGAATGGGTGTGAAGGTGGACTGGCGTCGTTCCTTCATCACCACTGATGTTAATCCTTACTATGATTCATTTGTCAGGTGGCAGTTTTTAACATTAAGAGAAAGAAACAAAATTAAATATGGGAATCGGTATACTATTTATTCTCCAAAAGATGGACAGCCTTGTATGGATCATGACAGACAAACCGGAGAGGGTGTTGGACCTCAGGAATATACTTTAATCAAGTTGAAAGTGCTTGAGCCATACCCATCCAAATTAAGTGGCCTGAAAGGCAAAAATATCTTCTTGATAGCGGCTACTCTCAGACCTGAGACCTTGTTTGGACAGACAAACTGTTGGGTTCACCCTGATATGAAGTATATTGGTTTTGAGGTGGCGAATGGTGATATATACATCTGCATCCAAAGGGCTGCCAGGAATATGTCATACCAAGGCTTTACCAAAGACAGTGGCGTGGTGCCTGTTGTTAAAGAATTAATGGGAGAGGAAATTCTTGGTGCATCAATTTCTGCTCCTTTAACATGTTATAAGGTGATCTATGTTCTCCCAATGTTCACCATTAAGGAAGATAAAGGTACCGGTGTGGTCACAAGTGTTCCGTCTGACTCCCCTGATGATTTTGTTGCCCTCAGAGACTTGAAGAAAAAGCAAGCTTTACGAGCCAAGTACGGGATTAGAGATGACATGGTGTTGCCATTTGAGCCGGTGTCAGTCCTTGAAATCCCAGGTTTAGGAGGTCTTTCTGCTGTAACCATATGTGATGAGTTGAAAGTTCAGAGCCAGAATGACCGAGAAAAACTTACAGAAGCAAAGGAGAAAGTATATCTAAAAGGGTTTTACGAAGGTATAATGTTGGTGGATGAATTTAAAGGACAGAAGGTCCAAGACGTAAAGAAGACTATTCAGAAAAAGATGATTGACGCTGGAGATGCACTTATTTATGTGGAACCAGAGAAACAAGTCATATCCCGGTCTGCAGATGAATGTGTCGTGGCCTTGTGTGACCAGTGGTACTTGGATTATGGAGAAGAGAACTGGAGAAAACTGACAACCCAGTGCTTGAAGAACCTGGATACATTCTGTGAGGAGACGAGGAGGAATTTTGAAGCTTCCTTAGATTGGCTACAATCACATGCTTGTTCAAGAACTTACGGTCTAGGTACTCGTCTGCCTTGGGATGAGCAGTGGCTGATTGAATCACTATCTGATTCCACTATTTACATGGCGTTTTATACCGTGGCACACCTGTTGCAGGGGGGTAACTTGCGTGGACAGGCAGAGTCTCCACTGGGCATCAGACCACAACAGATGACCAGGGAAGTTTGGGATTATGTTTTCTTCAAGGAGGCTCCATTTCCTAAGACTCAGATCCCAAAGGAAAAATTAGATCGGTTAAAGCAGGAGTTTGAGTTCTGGTATCCTGTGGATCTTCGAGTCTCTGGCAAGGATCTTATTCCAAATCATCTTACATATTACCTTTATAATCATGTGGCTATGTGGCCAGAACAAAGGGACAAATGGCCTGTAGCTGTGAGAACGAATGGACATCTTCTCCTCAACTCTGAGAAGATGTCAAAATCCACAGGCAACTTCTTCACTTTGAGCCAAGCTATTGACAAGTTTTCAGCAGACGGAATGCGCTTGGCTCTGGCTGATGCTGGTGACACTGTTGAAGATGCTAACTTTGTGGAAACCATGGCAGATGCAGGTATTCTCCGTCTGTACACCTGGGTGGAGTGGGTGAAAGAAATGGTAGCCAACTGGGACAGCCTAAGAAGTGGTCCTGCCAGCACCTTCAATGATAGAGTTTTTGCCAGTGAAATGAATGCAGGAATTATAAAAACAGATCAAAACTATGAAAAGATGATGTTTAAAGAAGCTTTGAAAACAGGATTTTTTGAGTTTCAGAAGTACGGGGAGAGAATTGGTAAATAATTTCAAATTTTATAGGCCGCAAAAGATAAGTACCGT