Transcript asmbl_70138

Sequence
Transcript Sequence for observation asmbl_70138 of TGE0006979:
GCGGGAGCCCAGGAGGGGGGCGGAGGCGAGGGGAGGCGGCGGCCGCGGCCAGCGCACCATTCGCTCCACCTGATCTCGGGGCGCTGTGCGCTGAGGAAGTCGCGGGCGAGCGGGAGCAGAAGGAGGGAGGGACGCCGCCGCTGCAGCCACCGCCGCCACCATGTCCTACCAAGGCAAGAAGAACATCCCGCGGATCACGAGTGACCGTCTTCTTATCAAGGGAGGCAGAATCGTCAACGATGATCAATCTTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAGCAAATCGGAGACAACCTGATTGTCCCTGGAGGAGTGAAGACCATCGAGGCCAATGGGAAGATGGTGATTCCTGGCGGCATCGATGTCCACACTCACTTCCAGATGCCCTACAAGGGGATGACCACAGTGGATGACTTCTTCCAAGGGACAAAGGCCGCCTTAGCGGGTGGCACAACCATGATCATTGACCATGTGGTGCCCGAGCCGGAGTCCAGCCTGACGGAGGCCTATGAGAAGTGGCGAGAATGGGCCGATGGGAAGAGCTGCTGTGACTACGCCTTGCACGTGGACATCACCCACTGGAATGACAGTGTCAAGCAGGAGGTGCAGAGCCTCATCAAGGACAAAGGGGTTAACTCCTTCATGGTTTACATGGCCTATAAGGATTTGTATCAAGTGTCCAACACAGAGCTCTACGAGATCTTCACCTGTCTGGGAGAGCTGGGAGCCATTGCTCAAGTTCATGCTGAGAATGGGGACATCATCGCCCAGGAGCAAAGCCGGATGTTGGAAATAGGGATAACTGGCCCAGAAGGCCATGTACTGAGCAGACCAGAGGAGCTGGAAGCTGAGGCCGTGTTCCGTGCCATCACCATCGCCAGCCAAACCAACTGCCCTCTCTATGTCACGAAGGTCATGAGCAAGAGTGCAGCTGACCTCATCTCACAAGCCAGGAAAAAAGGAAACGTGGTCTTTGGCGAGCCCATCACTGCCAGCCTCGGCACAGATGGAACCCATTACTGGAGCAAGAACTGGGCCAAAGCAGCTGCCTTTGTGACATCCCCACCTCTGAGTCCTGACCCGACCACTCCTGACTACATCAACTCCTTGCTGGCCAGTGGGGACCTGCAGCTTTCTGGCAGTGCCCACTGCACCTTCAGCACCGCCCAGAAAGCAATCGGGAAGGACAATTTCACAGCCATTCCCGAGGGCACCAACGGGGTAGAGGAGCGGATGTCTGTCATTTGGGACAAGGCTGTGGCCACCGGGAAAATGGATGAAAACCAGTTCGTGGCCGTGACTAGCACGAATGCTGCCAAGATCTTCAACCTGTATCCCCGCAAGGGAAGAATATCTGTGGGTTCTGACAGTGACCTGGTGATCTGGGATCCAGATGCAGTAAAGATTGTGTCCGCCAAGAACCACCAGTCGGCTGCAGAGTACAACATCTTTGAAGGGATGGAGCTGCGTGGAGCCCCTCTGGTGGTCATCTGTCAGGGCAAGATCATGCTGGAAGATGGCGGCCTGCACGTGACCCAGGGGGCTGGCCGCTTCATCCCCTGCAGCCCCTTCTCCGACTATGTCTACAAGCGCATAAAAGCCAGGAGGAAGATGGCAGACCTGCACGCGGTCCCGAGGGGCATGTACGATGGGCCCGTGTTCGACCTGACCACCACGCCCAAGGCGGGCACCCCGGCGGGCTCCACGCGGGGCTCTCCCACGCGGCCGAACCCGCCCGTGAGGAACCTCCACCAGTCCGGATTCAGCCTGTCGGGAACCCAAGTGGACGAAGGGGTCCGCTCCGCCAGCAAGCGCATCGTGGCGCCCCCTGGAGGCCGTTCTAACATCACATCTCTGAGTTAAGCCACCCCTTCCCAAAGAGGGGCAGAAGCAGCAAGAGATTTTTTGAAGCCAAAATGGTACACCGATATTTAAGAAGGAAAGCGAAAACAGTTGCGATCTAAAGAATCAATAAGCCTCAAGCCTTATGTTTCTCCAATGTTACGCTCGCTTGCCTAGCTTTACGAAAATTGCTTTGTTTTCTGTCTGTGCCTAGCCTTGATTTGGTTGACTCCTCCCCCCCATTTGCATGCATGCAATCAGGCCACTAAGGTAAAAGAGTCTGCTATATAGTGTTGAGAGCGTGTGTAGTGCTGCATCTTAAGACAAGGGGACAGACAAAGCTGGATGTCAGGAAAATGAACAAAAGGGACACAGTTATTTGGGGTGAGTGGGTGGTGGGAGCCCAGAGCAAGATGGAGGGTTCAGCGGGGCTGGGGTAGG