Transcript asmbl_69983

Sequence
Transcript Sequence for observation asmbl_69983 of TGE0006960:
CTCCCAGAAAGGAAGGTAGAATTTGTTTTTATTGCCTGGTTTCTCATGGGAGTTTCCTTTTGCCTGCTAAAATCTGTGAACTGCCTATTCAGACCTACCTCTTCCAGAAAACCCTCCAGGCTGTTTTTGCCCATACTATTCTTCAAATTCCTACAACAGATAGTCTGACTAAGCAGTTTAATACTTGTCGTGTACAGCCCTTATCCTTTCATTGTTCTCACTTCATCTTTCTGATGGCACTCTGAGGCAACTTGAAGACAAAGGGCTTCTATCTCTTCTACAATCCCTAGCAGAAATAGTGGGTGCTCAGTTAACCTAGTGGCTGATTGAGGGTTGATCCAGCCAGTCCTCTAGCTCCTCCCATAGTCTTCCCAAACTGATCCATATTCTTCCTAGTTTCCCAAAATCATTCTCCTTACTGGGCTGAAAAAAGGAGGGGGTGGGGTTAGAATGACCAGTTGCCTTTCCTAAATCTGACCACCTTAAATGAGGGGCTGAACCCCCAATCTTGGCCTCATATATCTTATATTCTGGTGGGTTTTCTAATTCACTCTAGTAATGGAACCATTCAAATGCAATCTAGTGGGAAACCTCAATAATAAACAGACCATCATAGGGATGGGAGAGCCCAGAGGTGGCCTGTGTGGCCAGAGTGCTGAACTGTGCTATTCTAGCCCATGTCCAGGGGTAAAGGTGAGCCTTTCCCTCATTTGGCAACTGTTCTCACCTCTGGGGCCTACCCTGGGGATGTGGGATATATCCCTGCAGGCAAAACCCCCAACCCACAGGCTACAGAGTGCTGACCACAGGCCTGGGTGTGTCCCCTTCCTAGTTCCCCACAGCCACCACCACCCTTCAGAATGGCCAACAGGGGACCTGCTTATGGTCTGAGTCGGGAGGTGCAGCAGAAGATTGAGAAGCAGTATGATGCAGACCTGGAGCAGATCCTGATCCAGTGGATTACAGCCCAGTGCCGCAAGGATGTGGGCCGGCCCCAGCCTGGGCGTGAGAACTTCCAGAACTGGCTCAAGGATGGCACGGTGCTGTGTGAGCTCATTAATGGACTATACCCTGAGGGGCAGGCCCCAGTGAAGAAGATCCAGGCCTCCACCATGGCCTTCAAGCAGATGGAGCAGATCTCTCAGTTCCTGCAAGCAGCTGAGCGCTATGGCATCAACACCACAGACATCTTCCAGACTGTGGACCTGTGGGAAGGAAAGAACATGGCCTGTGTGCAGCGGACACTGATGAACCTGGGTGGGCTGGCAGTGGCCCGGGACGATGGGCTTTTCTCTGGGGATCCCAACTGGTTTCCTAAGAAGTCCAAGGAGAACCCTCGGAACTTCTCGGACAACCAGCTGCAAGAGGGCAAGAACGTGATTGGGCTGCAGATGGGCACCAATCGTGGGGCATCTCAGGCAGGCATGACCGGCTATGGGATGCCACGCCAGATCCTCTGATCCATCTCCAGCTCTTGCATCTACTCTCCCGTGGATGGTTAATATATATAGATAGATAGATAGATATGCATATCCATCTACATATATATATTAGCAGTGACATTCCCCAAGAGCTCCCTGAGCTTTCAACCTCCCCACTGCTAGGGTGAGGGCCTGGCCTGGCCTATCTCCTCTGGGGGTGCCCAATGGTAGCCTCTCCCCATGTGCTTACTAATACATTCCCTTCTCCAAACCCACAAAAACTGGACCAACTGGCCTCTTTTCTCCTGGGACCAAAATTTAGGGCTTCTTCCTTCCCCCACCCCATACCTCTTCTTCTCTGATCTCTGTGCCCTCAATCCATTCCTTGGCTGGGGGTTGGCAATGCTACCTTTGGACCTTCCTTCCACAAACATGCCTCACCCACAGCTGTGGCTACAGGGACTTAATTTATAAGGAGGGGCCAGTAGCGGCTGCCGCCCCTGCCGCAGCTGGACTGGGTTCACCACACATTGGAGGCAGCCTGCCCGGGCAGAGGCCCTCTTGGCTTCTCATTTTCCATTCCCCTCTCTGTGGCTAAGGGGTGCGGTGAGGGGACAGGGGATGGCGGGGAGCTGCCCACTCTGGGCTGGGGCTCGAAGAATCTGAGTTTACTGATTTCAATAAAGAATCTTTGTTTTTTTTGATGGA