Transcript asmbl_69981

Sequence
Transcript Sequence for observation asmbl_69981 of TGE0006960:
GCTGAAAACCTCCAGCCCGGCCCGAGCGCACCACTTGCCTTGCAGCCCCGCCAGGAGTTCGCGCTCTCTGCACTACCCTACGTTCCCCACAGCCACCACCACCCTTCAGAATGGCCAACAGGGGACCTGCTTATGGTCTGAGTCGGGAGGTGCAGCAGAAGATTGAGAAGCAGTATGATGCAGACCTGGAGCAGATCCTGATCCAGTGGATTACAGCCCAGTGCCGCAAGGATGTGGGCCGGCCCCAGCCTGGGCGTGAGAACTTCCAGAACTGGCTCAAGGATGGCACGGTGCTGTGTGAGCTCATTAATGGACTATACCCTGAGGGGCAGGCCCCAGTGAAGAAGATCCAGGCCTCCACCATGGCCTTCAAGCAGATGGAGCAGATCTCTCAGTTCCTGCAAGCAGCTGAGCGCTATGGCATCAACACCACAGACATCTTCCAGACTGTGGACCTGTGGGAAGGAAAGAACATGGCCTGTGTGCAGCGGACACTGATGAACCTGGGTGGGCTGGCAGTGGCCCGGGACGATGGGCTTTTCTCTGGGGATCCCAACTGGTTTCCTAAGAAGTCCAAGGAGAACCCTCGGAACTTCTCGGACAACCAGCTGCAAGAGGGCAAGAACGTGATTGGGCTGCAGATGGGCACCAATCGTGGGGCATCTCAGGCAGGCATGACCGGCTATGGGATGCCACGCCAGATCCTCTGATCCATCTCCAGCTCTTGCATCTACTCTCCCGTGGATGGTTAATATATATAGATAGATAGATAGATATGCATATCCATCTACATATATATATTAGCAGTGACATTCCCCAAGAGCTCCCTGAGCTTTCAACCTCCCCACTGCTAGGGTGAGGGCCTGGCCTGGCCTATCTCCTCTGGGGGTGCCCAATGGTAGCCTCTCCCCATGTGCTTACTAATACATTCCCTTCTCCAAACCCACAAAAACTGGACCAACTGGCCTCTTTTCTCCTGGGACCAAAATTTAGGGCTTCTTCCTTCCCCCACCCCATACCTCTTCTTCTCTGATCTCTGTGCCCTCAATCCATTCCTTGGCTGGGGGTTGGCAATGCTACCTTTGGACCTTCCTTCCACAAACATGCCTCACCCACAGCTGTGGCTACAGGGACTTAATTTATAAGGAGGGGCCAGTAGCGGCTGCCGCCCCTGCCGCAGCTGGACTGGGTTCACCACACATTGGAGGCAGCCTGCCCGGGCAGAGGCCCTCTTGGCTTCTCATTTTCCATTCCCCTCTCTGTGGCTAAGGGGTGCGGTGAGGGGACAGGGGATGGCGGGGAGCTGCCCACTCTGGGCTGGGGCTCGAAGAATCTGAGTTTACTGATTTCAATAAAGAATCTTTGTTTTTTTTGATGGA