Transcript asmbl_69565

Sequence
Transcript Sequence for observation asmbl_69565 of TGE0006944:
GGCGGCGGCCGCGTAGTCTTTCCTGCCCCTTGTCCGCCTCTTCTTCCTGCTCGCGGCCCGCCCGCCGGCTCGCACCCAGCCGCAGCGGCGTGGACGGAGGATACGACTGGGACGGCGCCGGGAGCCGAGGTGCTGAGGGACGGTGGCCGACTTAGGAGAGATGCTGGGCGTGGCGGCAGGAATGACCAACAGCAACATGGCCAATGCCCTTGCCAATGCTGCTTGTGAGCGCTGCAGGGGGGGTTTTGCACCCGCCGAGAAGATTGTAAACAGTAATGGCGAGCTGTACCATGAGCAGTGTTTTGTGTGTGCTCAGTGCTTCCAGCAGTTCCCAGAAGGACTCTTCTATGAGTTTGAAGGAAGGAAATACTGTGAACATGATTTTCAGATGCTCTTTGCTCCTTGCTGTCATCAGTGTGGCGAATTCATCATTGGCCGAGTTATCAAAGCCATGAATAACAGCTGGCATCCTGAGTGCTTCCGCTGTGACCTCTGCCAGGAAGTGTTGGCAGATATCGGGTTTGTCAAGAACGCTGGGAGACATCTGTGTCGCCCCTGTCATAATCGTGAGAAAGCCAGGGGCCTTGGAAAATACATCTGCCAGAAATGCCACGCCATCATTGATGAGCAGCCTCTAATATTCAAGAACGACCCTTACCATCCAGACCATTTCAACTGTGCCAACTGCGGGAAGGAGCTGACTGCTGATGCTCGGGAGCTGAAAGGAGAACTGTACTGCTTGCCGTGCCATGATAAAATGGGGGTCCCCATCTGTGGTGCCTGTCGACGGCCCATTGAAGGGCGTGTGGTAAATGCCATGGGCAAGCAGTGGCACGTGGAGCATTTTGTTTGTGCCAAGTGTGAAAAACCATTTCTTGGACATCGCCATTATGAAAGGAAGGGCCTGGCATATTGTGAAACCCACTATAACCAGCTATTCGGTGATGTTTGTTTCCACTGCAACCGTGTTATAGAAGGTGATGTGGTTTCTGCTCTTAATAAGGCCTGGTGCGTGAACTGTTTTGCCTGTTCTACCTGCAACACTAAGTTAACACTCAAGAATAAATTTGTGGAGTTTGACATGAAACCTGTCTGTAAGAAGTGTTATGAGAAATTTCCACTGGAGCTGAAGAAAAGACTTAAGAAACTAGCTGAGACCTTAGGAAGGAAATAATTTCCTTTATTATTTTCTTCTTTGCAAAGATCAGAGATTACCAACATTATTGATGTGATCTACCCTTATTTAAACCTATTTCTCAAAATAGTTGAGAGTGAAGAAAACCTACATGGTTTTCTTCATCTCTTTTTTTCTCATTAAAAAAGAAAATAAATTTGTGTAATCATATTTAAAACAGATAAAATCAAGATTTGCCTTTGTCAGTAATCATCAATTTGTTTAAGTATAGACTATACTTAATAGCAAAAATCACATAGCTAAATGTTAATTAAGGTCCAAAAATTTACATACAACTTTTTAAAAATGAAAGTAATGAGTCAGCTTTTATAAGACACAGCTAAAAAATATAAACTTTATTTTACTTTGTACTCAAAAGAAAATTAAATCCAACTGCTGTTAGGGACATTGTAGAGAAGAAAACTAACCAAGAAAAACAAATCTTATGGAATCTTAGTATGTTAATCAGACTGGTAGCTACAAAATGAATATACACATTACTAAGACAAGAAACAAGTATATTCAGAACTACTTGATTTTAGAGGTTTTTTGTTGTGAAATTCAATAATTATGCTGTTTTATATTTTGTTCTCCTTGTGAACTTCTTCTTTCATACAATTACTTAACATAGTTACGGCTAGCTTATAGTATGTTTTTTTTAATTTTGTGCAAAAAAAATTTATTCTATGTATTTGACAATACAGCATACTTTACAATATTGGAAAATGGAGTATTTTTTAATGTATTACAGCAATTATGTTTCTAAACATAAGGTCAAAGATGTAGTCTTAGAATAGGACATGAAATTAAATTTTATGTAGCTTGGATGTATCATTTAAAAAAAGTGAATGTATACGTATTGGTCATATTACCTTTATTATAACCATATTAATATCTATGCTTTATACATAACCTTGCCTTGTCTTAGAAAAACACATACCTTAATCAGGAATTCAAGCAGCTTCATATAATACCAACTAAAAATAGGTACACTGGTTGAGATTTATAAACTCAAATTTATTTGCCACAGCTACGATTATTTAAAAAAAATTTTTTTCTCCCTTTTTGGGAAACATTAAAATTAATTTCTGCCATCTTAGTATAAGAGAATGATGTTGATATGTTTCAAGTTTTTCACTTCAAATTTCATAATTAATTGAATTTATTTGCTATAAGTAAGAAGTATAAATGATACTTTTAAATTGGAAAAGGGATGTTTAAGTGTCAATTTTAGGTCAAAAAGTCATGAATTATTCTACTTTATCTTATTCTGAAGTTTCTGGACCATTCTTTCTCGATAAACTTGGATGCAAAGCAAACTTTGTGAACATTATTTAAATGTTGCTGTGTTATTTAAAAGAAAGTTGCCAAGATGGACTTCTAAAGGGAAAATGATTGTTTTCTCCAGAATTTTCTAAAATATTGTTTTGGCATTAAAAATATCTCAGGATGCTACTACTCTGCCATTAAAATATTTGTATGCATGTATTAAAAAGTATGCATGTACTTTATGAGATAAATTCTATTTCGGTTTTCAGATAACTTTATTTTTTAGTGTTCTTTTAGAGTTCAAAGAATTACAGAAGATTGAAATTAATCAATATATATAGTTAAGACTGCATGAGTTCTGAAGTTTCAAACAGTCTTTGCATTTGACAGTAAGAATCGAAATCCCTTCCATGTGCCTTTGTCAGCTAATTTATGACCAGCAGTGAAAACTTTAAAAGTATATAGGGTCTGGATGTTAAATTCTTAAATACCCTACACCAGAAATATGGAGCAGAAAAGTAACTATTTACCTATATCTTAATCACTTTGAAGATGCATGGACAGAACTCAGCTGCTTTGTTTACATATCTTACATAGACAGGTCTCTCCTATTGCCAGAGGTCCCACTGCTATCTTTGCTCACTCTTCTCTTAATATATGAATTAATATTTCTGAAAGTTCAACTTTTTAAGCCTCTAACACTTTAGGGTATTTTATGTAGATACAGTGCTTTCTTCCTCAATAGGGCTATCATTGGAACCCTTATATGTGGGAAAAGAGGAAGCAGTTGAAAAGTTCTAAGTGGAACAGAAGACAAACTTGGTTTAGTTCATACTATTTTTCATGGAGCTTTCTCTAGCTGTGGAAAAACTCAGGCTAGTAAGTATCTATTTAAAGTCTTGCAACGCAATTTTAAATAATTCATAGTTCTTACCATATTTCTAAATGCTCTTTTTCTTACCAAGCCTAATATAATTGGGAAAAAATGTCTGGATACAAATAAAACATTCTTTAGATCATGTTCAAAGCCTTATTAACATTGCACCTGAAATGACAGGCCACTCTGCCTCACTTATTTGCCAAAATGCCATTTCTAAGTTAAGGAAAATTTGAGGTAGGCTTACAGCATTCTTATTGTATTTACTTTTAGATTGTAAGCTCAATGGCAGGGGCACTATACTGATAATTATGTTTTTATATAGCAACCATTGCAG