Transcript asmbl_6887

Sequence
Transcript Sequence for observation asmbl_6887 of TGE0006634:
GGGGCCGCGCAGGCGCAGTTATGCGGTAGGTTCCCAAGATGTCGTTCCCCAAGTACGAGCCGTCGCGCCTGGCCACCTTGCCCTCTACCCTTGACCCAGCTGAGTATGACATATCCCCGGAAACCCGGAAGGCGCAAGCCGAGCGGTTGGCCATAAGATCTCGGCTGAAAAGAGAGTACCTGCTGCAGTACAACAACCCTAGCCGCCGAGAGCTCATTGAAGATCCTGCCTTGACTCGTTGGACCTATGCAAGATCTGCAAATATCTATCCCAATTTCAGACCCACTCCCAAGACCTCACTCTTAGGAGCTGTTTTTGGATTGGGGCCCCTTTTCTTCTGGTATTATGTTTTCAAAACTGACAGAGATAGGAAAGAAAAACTTATTCGGGAAGGAAAATTGGATCGAACATTTAACATCTCATATTAATTCTGGCAATGATGACTATGTGTATTATGTTTAAATAAATCTATTAATCATTAAATAGTTTTTCTTTCTTAATGTTACCTTAATTCAATAAAC