Transcript asmbl_68605

Sequence
Transcript Sequence for observation asmbl_68605 of TGE0006898:
CCCGTATCTGGGTGACTTCTTGGTTGCCCAGTTGCTGTCGGCTCCCCACCCCCAGCTCCTGTGCGGTCCCGCGGGCCTCCCGATTTCGGCTTGCTTTCCCCCTTTCGGGACCTCCCTCTCCGGTTCCCTCTGGGCCTTCAGCCCCTGATTGCCCGGGCTTGCCGCGCCGTCGCTCGTCGCTGTTGTCTGAGGAAAGATGAATGGGAGGGCTGATTTTCGAGAGCCGAATGCTGAAGTTGCAAGACCAATTCCCCACATAGGGGCTGATTACATTCCAACAGAGGAAGAAAGAAGAGTCTTCGCAGAATGCAATGATGAAAGTTTTTGGTTCAGATCTGTGCCTTTGGCTGCAACAAGTATGTTGATTACTCAAGGATTAATTAGTAAAGGAATCCTTTCAAGTCATCCCAAATATGGTTCCATTCCTAAACTCATATTTGCTTGTATCATGGGATACTTTGCTGGAAAGCTTTCTTATGTGAAAACGTGCCAAGAGAAGTTCAAGAATCTTGAGAATTCCCCTCTTGGAGAAGCTTTACGATCAGGACAGGCACGACGATCTTCACCACCTGGACACTACTCTCAAAAGTCAAAATATGACTCAAATGTGAGTGATCATTCATCTTTTGTGACATCACCAGCAGCAGACAACATGGAAAAAGAGATGTTTTCTCATTATGAGCCAGTTCCATTCAGTGCTTCTATGAATGAATCTACTCCCACTGGTATAACTGATCATATTGCGCAAGGTAGAAACTTCTCTTGAAATGAATTTCAGCATTTTATGGTCCAACGTATGTATAAACTTTATTTGATGACCTTTTCTGCTGGATATCACCTATATGTTCCACCATCAGTCTAAACTCAGCATGTTTGTTCATTTCTTTCTTCATTCATTTAACATTTTTTTTTCATTTACTATTTTTGAGGTCCATTAGGTATCAGGCATTCTGCTAGCTATGTTAGAAGTAAATATGAATAAGACTTGGTTCTTTTCTCTGAGAAACTCTCTGTCAGTAAATATAGAAATATAAGGATAAATTACTAGTATGTCCCATCAGTTAAATACTAACCGGGTTTAGCAGAATAGCAGAGAAGTGATAAGTGCCTCAGGGGGAGGCTTTAAAAAGTTTACATTTGTTAAGCTGATCTTAAAGGCTTTCAGCTCCTTTGCTTGTAATATGAGAAAAATACTAATTACCTGCCTTTCAAAACTGTTGTCAGGTGAGAAAATCCATGAGAAAATGCTCTGTGAAGTTTATGTAAACTCTAGCTTTGAAAATCACATAAGTAAGTGAACAATATCAACTTTGGATTAAGGCCTGGATTTGATTCATGATTGACATTTACTAGCTCTATGACTTTTGGCAAGTAACTAATTTGTGATCCCTTCAATTTCTTGATCTCTTGAATGCAGATGACAATACCTCTTTTAAAGAACTTTTGGAATGAGATGAAATAATCAGAGGTAACGCCTGGCAAGTAATAGGCTCTCAACAGACATTAGTTTCCTTCTTTTCTTCCATAAGTCTAATTTACAGTGAAAGGTGAGAAAGTATAGGTCTGCAATTTGTTACCTGAAATCCTAAAATCCAAAAAGCTTTGAAAACCGAAGTTTTTAAAAATAATTAAACAGGTGGTAAAGTCTGACCTAAACGCATTTCCAACCCTGACCTAAACTGACATAAGTTTAAATTCTGAGGAAGTCTGAATTTTGAAACATTTCTGACTCTTCAAGGATTTGGATAAGGGATTGTGGACCTCTATAGAGAATTCTTTGAAAATGCTTACTTTGAACCAAATACAATAAGCAAGCAATTAATGGGGAACAAACAGTGTTTAAAGGAACACTTTGATTTTTATTTCTTTTGTTTAAGTTGGGAGA