Transcript asmbl_12082

Sequence
Transcript Sequence for observation asmbl_12082 of TGE0003624:
CTCAAATCACTGTCTAAGTTCGGATTCTGAAATAATAGGTTATGCTTTGGACACACTCTTTAATATAATATCTAATGATGAAGAAGAAGAAGTAGAAGAAAATTCCACAAGACAGAGTGAGGATTTGGGAAGCCAGTTTACAGAAATTTTCATTAAGCAACAAGAAAATGTCACTCTCCTGTTATCTTTATTAGAGGAGTTTGATTTCCATGTCCGCTGGCCTGGTGTAAAGCTTCTTACTTCTCTTTTAAAACAGTTAGGGCCTCAGGTGCAGCAGATTATTTTAGTCAGTCCCATGGGTGTTTCAAGATTGATGGACTTATTAGCGGATTCCAGAGAAGTTATACGAAATGATGGTGTCTTACTACTACAGGCATTAACAAGAAGCAATGGAGCAATCCAGAAAATTGTTGCTTTCGAAAATGCTTTTGAGAGACTACTGGACATTATTACAGAGGAGGGAAACAGTGATGGAGGTATAGTAGTGGAAGATTGTCTAATTTTGCTCCAAAACTTATTAAAAAACAACAATTCCAATCAAAACTTTTTTAAAGAAGGCTCATATATTCAACGTATGAAACCTTGGTTTGAAGTTGGAGATGAAAATTCTGGCTGGTCTGCACAGAAAGTAACTAACCTGCACCTAATGCTACAGCTTGTTCGTGTCCTGGTATCTCCCACCAATCCTCCTGGTGCTACTAGTAGCTGCCAGAAAGCTATGTTCCAGTGTGGTTTATTGCAGCAGCTTTGCACTATCCTAATGGCAACAGGAGTTCATGCTGATATCCTGACTGAGACCATTAATACTGTATCAGAAGTTATTCGAGGCTGCCAAGTAAACCAAGACTACTTTGCTTCTGTAAATGCTCCTTCAAACCCACCAAGACCGGCAATTGTAGTACTTCTCATGTCCATGGTTAATGAAAGGCAGCCATTTGTATTGCGCTGTGCTGTTCTCTATTGTTTCCAGTGTTTCTTATATAAAAACCAAAAAGGACAAGGAGAAATTGTGTCAACACTGCTACCTTCTACCATTGATGCAACAGGTAATTCAGTCTCGGCTGGTCAGTTATTATGTGGAGGTTTGTTTTCTGCTGATTCACTTTCAAATTGGTGTGCTGCTGTGGCCCTTGCCCATGCTTTGCAAGAAAATGCCACCCAGAAAGAACAGTTGCTCAGGGTTCAACTTGCTACCAGTATCGGCAATCCTCCAGTATCTTTGTTGCAACAGTGCACCAACATCCTTTCACAGGGAAGCAAAATACAGACAAGAGTTGGATTACTAATGTTGCTTTGTACCTGGCTAAGCAACTGTCCCATAGCAGTAACACATTTTCTTCACAATTCAGCCAATGTTCCTTTTCTTACAGGACAAATTGCAGAAAATCTTGGAGAAGAAGAGCAGTTAGTCCAAGGCTTATGTGCCCTTCTGTTGGGCATTTCGATTTATTTCAATGATAACTCGCTTGAGAGCTACATGAAAGAGAAACTAAAACAACTAATAGAGAAGAGGATTGGCAAAGAGAATTTCATAGAGAAACTAGGATTTATTAGCAAACATGAGTTGTATTCCAGAGCATCTCAGAAACCCCAGCCCAACTTCCCCAGTCCAGAATACATGATATTTGATCATGAGTTTACAAAACTGGTAAAAGAACTTGAAGGTGTAATAACTAAGGCTATTTATAAGTCCAGTGAAGAAGATAAAAAAGAAGAAGAGGTGAAGAAAACATTAGAACAACATGACAATATTGTGACTCACTACAAAAATGTGATTCGAGAACAAGATCTGCAACTTGAGGAATTAAAGCAGCAGATTTCTACATTAAAATGTCAAAACGAACAGCTCCAGACAGCAGTCACACAGCAAGTATCTCAGATTCAGCAACACAAAGATCAGTATAATCTTCTTAAAGTACAGCTAGGAAAAGACAATCAGCATCAAGTTTCTTCCAGTGATGGGGCTCAAATGAATGGCATTCAACCAGAAGAAATTGGTAGGTTGCGAGAAGAGATAGAAGAATTAAAAAGTAATCAGGAACTTTTACAAAGTCAACTGGCTGAAAAGGACTCTCTGATTGAAAATTTGAAATCGTCCCTAACAACCCCTGGCACAAATGAAGCAACAGCTTCAGCTGGAGAGTCTGAACAAATTGCAGAATTAAAACAGGAACTGACAACATTAAAGTCTCAGTTAATCTCACAATCTGGGGAGATCACCAAACTACAGACAGAAAAACAGGAGCTGTTACAGAAAACAGAAGCATTTGCAAAATCAGTTCCTGTACCAGTAGAGAGTGAAACTGTAATAGCTGCAAAAACTGCTGATGTAGAAGGGAGACTATCGGCATTATTACAAGAGACCGAAGAATTAAAGAATGAAATTAAAGCTCTGTCTGAGGAAAGAGATGCTATTAAAGAGCAGCTGGACTCATCTAACAGTACCATTGCCATTTTACAAAACGAGAGAAACAAGCTCGAGGTGGATATTACAGACTCTAAAAAAGAACAAGATGATCTCTTGGTGCTGTTGGCTGATCAGGATCAGAAAATATTTTCATTGAAGAATAAACTCAAGGAATTTGGTCATCCAATTGAAGAAGAGGATGAACTTGAATCTGGAGACCAAGATGATGAGGATGACGAAGATGAAGATGACAGCAAGGACCAGAGTCATATCCAGCTTTAAAATTTCTAGGAATGCTAGAGATCATATTATAACTTTGAACATGGAGTCTTAAGACAGTGCTTTGGTTTGCTTCCACAGAAAATAAAATTTAGAAACCAAGTGGAAAACGTTCACTAATAAGACTATTGATGTATTTTTTAAACAATGCCACCCATGTTGAAAACTCTTAAAACTCTATGTAGAACATACATCTTTTATTGAAATTCATCTGAACTGTCCCAAAATATAATTTGTGAAGAGCTTGAAACACTAAAAATATACCATGTTAAGACATGTGGTGGCAGTGCTATTTGCCTTAGTTCATTGGTTGTTCACGTAAGTTCTGTTTGTTATTTTCACTTTTCAGAATTTATGACTACACATTTAATGTGTTTTGGAATCATTGTTTCTAAATTCATCATTGGAGCTCTTAGCTAATGATTTCCTTTTAAAGAAATGAAGTTGCTTAAAGGCAAGATCATATGGGCTGGAGGTGGGTATAATATATATCATCAGCCCTCGATCCAATGGGACCCCTAAGATGAGCAGGATAAGACAGTGTAGAATGAGTGCCTTGACACATGATATGGCTGTGTTCTGTACCTAAGAAACAGGATACTGACATAGTGATAAAGGAGAGCCTTTCTGAGAAACTTTTACAACAGTATGTTAGCAGGTGGTTGGTTTTGGTTTTATTTTAAGCTAAACATTAAAACAAATTATAAGTTAACGGCTCATGCAACTCAGATTTAGTATTGTTTGATTATCATAAAACATATTATGTTCCTAGTTTTAAAAAAACTATGAT