Transcript asmbl_68089

Sequence
Transcript Sequence for observation asmbl_68089 of TGE0025672:
GATCCAGAGACAATGGCCCGGATGGAATGGAGCCCGAAGGCGTCATCGAGAGTAACTGGAATGAGATTGTTGACAGCTTTGATGACATGAACCTCTCGGAGTCCCTCCTCCGTGGCATCTATGCCTATGGTTTTGAGAAGCCCTCTGCCATCCAGCAGCGAGCCATTCTTCCTTGTATCAAGGGTTATGATGTGATCGCTCAAGCCCAATCTGGGACTGGAAAGACGGCCACTTTTGCCATATCAATTCTGCAACAGATTGAATTGGATCTGAAGGCCACTCAGGCCTTGGTCCTGGCACCCACTAGAGAGTTGGCACAGCAGATACAGAAAGTAGTCATGGCATTAGGAGATTACATGGGTGCCTCCTGCCATGCCTGTATTGGGGGCACCAATGTGCGTGCTGAGGTGCAGAAGCTGCAAATGGAAGCTCCCCATATCATCGTCGGTACCCCAGGCCGTGTGTTTGATATGCTTAACCGGAGATACCTGTCTCCTAAATACATCAAGATGTTTGTACTGGATGAAGCTGATGAAATGTTAAGCCGTGGATTCAAGGACCAGATCTATGACATATTCCAGAAGCTCAACAGCAACACTCAGGTAGTTTTGCTGTCAGCTACAATGCCTTCTGATGTGCTTGAGGTGACCAAGAAGTTCATGAGGGATCCTATTCGAATTCTTGTCAAGAAAGAAGAGTTGACCCTGGAGGGTATCCGCCAATTCTACATCAATGTGGAACGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTATATGAAACCCTCACCATCACCCAGGCTGTCATCTTCATCAACACTCGAAGAAAGGTTGATTGGCTCACTGAGAAGATGCACGCCCGAGACTTCACCGTCTCTGCCATGGTGAGTTCTCCCTACCTTTTTACCAACAGTGTGTATGTGCCAGTGTCCCACTTACAGCCAGTCCACAGAACCAGTATACCTGTTAAACTGTTCTATTTTCTAGCATGGAGATATGGACCAAAAGGAACGGGATGTAATCATGAGGGAGTTCCGCTCCGGTTCTAGCAGAGTATTGATTACCACTGACCTGCT