Transcript asmbl_12063

Sequence
Transcript Sequence for observation asmbl_12063 of TGE0003620:
GGCGCGGCTTCCCTCTCTCCCTCTCCCTGGCCTCCGGGGGCGGTCAGGTGGAGTAGGAGGCGGGAGGAAGGGCAGGAGGAAGGGGTGCGGTCGCAGTCGCGGTCACGGTCGCGGGCCGGGAACGAGCTCCGAACACCAGCCCGCGAGGCCGCACACCTGTCTGGCTGTTCTGCCGCACACCAGTCCCCGCAGCCTCGCTTCAGGGTTAGTGTGACCTGAACTTAAGGCAAAGGTGGTATATCATGGCATCTCTCTGGGTTGGACACCGAGGGACAGTGCGAGATTATCCAGGCTGTAGCCCATCAGTGGATGCTGAAGCGATTCGTAAGGCAATCAGAGGAATTGGAACTGACGAGAAAACACTCATCAGCATTCTAACTGAGAGGTCAAACGCACAGCGGCAGCTGATTGTTAAGGAATATCAAGCAGCGTATGACAAGGAACTGAAAAATGACTTGAAGGGCGACCTCTCTGGCCACTTTGAGCATCTCATGGTGGCCCTCGTGACTCCTCCAGCAGTGTTTGATGCGAAGCAGCTGAAGAAATCCATGAAGGGCACTGGAACAAATGAAGATGCATTGATTGAAATCTTAACCACCAGGACAAGCAGGCAGATGAAAGAGATCTCTCAAGCCTACTACACAGTATATAAGAAGAGTCTTGGAGATGACATTAGTTCTGAAACATCTGGTGACTTCCGGAAAGCTCTGTTGACTTTGGCAGATGGCAGAAGAGATGAAAGTCTGAAAGTAGATGAGCATTTGGCCAAAAAAGATGCCCAGATTCTCTATAATGCTGGTGAGAACAGATGGGGCACGGACGAAGATAAATTCACTGAGATCCTATGTTTAAGGAGCTTTCCTCAACTAAAACTAACATTTGATGAATACAGAAATATTAGCCAGAAGGACATTGAGGACAGCATAAAAGGAGAATTATCTGGGCATTTTGAAGATTTGCTGCTGGCCATAGTTCATTGTGCAAGGAATATGCCTGCCTTTTTAGCTGAAAGACTACATCAAGCTTTGAAGGGTGCTGGAACTGATGAGTTCACTCTGAACCGAATAATGGTTTCCAGATCAGAAATTGACCTTTTGGACATTCGAGCAGAGTTTAAGAAGCAGTATGGCTACTCCCTAAATTCAGCAATTAAATCGGATACTTCTGGAGACTATGAAATCACACTCTTAAAGATCTGTGGAGGAGATGACTGAGTCAAGAACATCATCTCCAAAGGTTGTTTGCTTCCATGATGGGCTTCTCCAACAGCTCTGCTTACTTCTCTTTCACGGGATTTAAAAGTACAAGAAGTATAAACAGCAATCTGTTTTTCGTAACAGAAATTGTCATTGTTCCATAACAACAACAAAGTGATTATCTTAAAGTATTTCATCATAATGTAGTAGTTTATAAGTGAAAATTTAAAATGGTATAAAGAATCCGCTAATACTCTCCAAATTATATTTCTACTTAGGAAGTGAGAATCATTGTACAGTTCTAAAACATTAAATGCAAAAACAAGGTAATAAAAGTTGTCACCTTTGTTAAA