Transcript asmbl_12044

Sequence
Transcript Sequence for observation asmbl_12044 of TGE0003617:
CCGCGGCCCCTGCGAGGGTGACACACTATGATCACGGCCCCTAGAGACCGTCGTGCTGGCAAGCAGCACACCCTAGCTCCCCGGTCTGCCTCGGCCACCTCGGCAGCGCTCGAAGCCAGCAGCAGGAGTTGAGCTGCCCTGCGCCCGAGGGTTTTGGCGAAGCCCTTGGTGGCGCGCTGAGCACAGGAGGACGAAGAGGCTGAGCGTGCGCTCCTGGGTCAGGCGGTCGGCTGGGGTCGCCGCTGGAGGGGCGTTTCCGAGGAGTGGAGGAGGAGGAGGAGATGCTGCTCCTCTTCTCGCCCTCCCCAGGCTCCTTCTCCAGCTCCGCCGTCCCACACCCGCAGCCGTTTGGGGGAGAAGAGGTGGTGGCTCTCGGCGCCCGCGGCGGCTGCCCGCGGCCCGCCCCGACGCCGCGTCCCCGCAGCCCTCGCCCCGCGCTCCCGTAGCAGGACCGGGTCTGCGGCAGCGGGGTAACATGCATGTGTCACTAGCTGAGGCCCTGCAGGTTCGGGGAGGACCACTGCAAGAGGAAGAAATATGGGCCGTATTAAATCAAAGTGCTGAAAGTCTCCAAGAATTATTCAGGAAAGTAAGCATAGCTGATCCTGCTGCCCTCGGCTTCATCATTTCTCCGTGGTCTCTGCTGTTGCTGCCATCTGGTAGTGTGTCATTTACAGATGAAAACATTTCCAATCAGGACCTTCGAGCGTTCACTGCACCGGAAGTTCTTCAAAATCAGTCACTAACGTCTCTCTCAGATGTTGAAAAGATCCATATTTATTCTCTTGGAATGACATTGTATTGGGGGGCTGATCATGAAGTACCTCAGAGCCAACCTATCAAGCTTGGAGATCATCTCAACAGCATACTTCTTGGAATGTGTGAGGATGTTATTTACGCTCGGGTTTCTGTTCGGACGGTCTTGGACGCCTGCAGTGCCCACATTAGGAACAGCAATTGTGCACCTTCATTTTCCTACGTGAAACAGTTGGTAAAACTGGTTCTGGGAAATCTTTCTGGGACGGATCAGCTTTCCCGTAACAGTGAACAAAAGCCTGATCGAAGCCAGGCTATTCGAGACCGATTGCGAGGAAAAGGATTACCAACAGGAAGAAGCTCTACTTCTGATGTACTAGACATACACAAGTCTCCATTCTCTCATCAGACCTTTCTTAACAAAGGGCTTAGTAAATCTATGGGATTTCTGTCCATCAGAGATACACAAGATGAGGAAGACTATTTCAAGGACATTTCATCAGATAATAATTCTGGACATGAAGATTCTGAAAATACCTGCCCTCCTTACCAGTTCAAAACTAGTGGCCCAGAAAAAAAAGCTCTTCCTGGCTCCGATGTCCTATCCAAGAAGAAGATCTGGGCTTCATCCATGGACTTGCTTTGCACAGCTGACAGAGACTTCTCTTCTGGGGAGACCTGCAGATATCGACACTGTCTCCCTGAGGCAGTAGCAGTGCGGTCTTCAACTGCTCCTAGAAAAAAGGAAGCAAGATACTCAGATGGAAGCATAGCCTTGGATATCTTTGGCCCTCAGAAAATGGATCCTATATTTCACACACGAGAATTGCCCACCTCCTCAGCAATATCAAGTGCTTTGGACCGAATCCGAGAGAGACAAAAGAAACTTCAGGTTCTGAGAGAAGCCATGAATGTAGAAGAAACACCTCGAAGATACAAAACTTACCACGGTGATATCTTTAGTACCTCCAGCGAAAGTCCATCTATTATTTCCTCTGAATCAGATTTCAGACAAGTGAGAAAAAGTGAAGCTTCAAAGAGATTTGAATCCAACAGTGGCCTCCCAGGAGTGGATGAAACTCCAAGTCAAGGCCAGTCACACAGACCAAGCAGACAATATGAAACACCCCTTGAAGGCAACTTAGTTAATCAGGAGATCATGCTAAAACGGCAAGAAGAAGAAATGATGCAGCTCCAAGCCCGAATGGCCCTTAGACAGTCTCGGTTGAGCCTGTATCCGGGAGATACAATCAAAGCTTCCATGCTTGACATCACCAGGGATCCATTAAGAGAAATGGCCCTAGAGACAGCCATGACACAAAGAAAGCTGAGGAATTTCTTTGGCCCCGAGTTTGTGAAGATGACAATTGAACCATTTATATCTTTGGATCTGCCACGGTCTATCCTTACCAAGAAAGGGAAGAATGAGGATAATCGAAGAAAAGTAAACATAATGCTTCTGAATGGGCAAAGACTGGAACTGACTTGTGATACCAAAACTATATGTAAAGACGCGTTCGATATGGTTGTGGCCCATATTGGCTTAGTGGAACATCATCTGTTTGCTTTAGCTACCCTCAAAGATAATGAATATTTTTTTGTTGATCCTGATTTGAAATTAACCAAAGTGGCCCCAGAGGGATGGAAAGAGGAACCAAAGAAAAAGAACAAAGCCACTGTTAATTTTACTTTGTTTTTCCGAATTAAATTTTTCATGGATGATGTTAGTCTAATACAACATGCTCTGACCTGTCATCAGTATTATCTTCAGCTGCGAAAAGATATCTTGGAGGAGAGGATGCACTGTGATGATGAGACTTCTTTGTTGCTGGCATCCTTGGCTCTCCAGGCAGAGTATGGAGATTATCAACCTGAGGTTCATGGTGTGTCTTATTTTAGACTGGAGCATTATTTGCCTCCCAGAGTGATGGAGAAACTTGATTTATCATATATTAAAGAAGAGTTACCCAAATTGCATAATACCTATGTGGGAGCTTCTGAAAAAGAGACAGAGTTAGAATTTTTAAAGGTCTGCCAAAGGCTGACAGAATATGGAGTTCATTTTCACCGGGTGCACCCTGAGAAAAAGTCGCAAACTGGAATATTACTTGGAGTCTGTTCTAAAGGTGTCCTTGTGTTTGAGGTTCACAATGGAGTCCGCACACTGGTCCTTCGCTTTCCATGGAGGGAAACCAAGAAGATTTCTTTTTCGAAAAAGAAAATCACATTGCAGAATACATCAGATGGAATAAAACATGCCTTCCAGACAGAAAACAGTAAAGTATGCCAGTACCTGCTGCACCTCTGCTCCTCCCAGCATAAGTTCCAGCTGCAGATGAGAGCAAGACAGAGCAACCAAGATGCCCAGGATATTGAGAGAGCTTCGTTTAGGAGCCTGAATCTCCAAGTGGAGTCCGTTAGAGGATTTAATATGGGACGAGCTATCAGCACTGGCAGTCTGGCCAGCAGCACCCTGAACAAACTTGCCGTTCGACCTCTGTCAGTTCAAGCTGAGATCCTGAAGAGGCTATCCTGCTCAGAGCTCTCGCTTTACCAGCCATTGCAAAACAGTGCAAAAGAGAAGAGTGACAAAGCTTCATGGGAGGAAAAGCCTAGAGGAATGAGTAAATCATATCATGATCTCAGTCAGGCCTCTCTCTATCCTCATCGGAAAAATATCACTGTTAACATGGAATCACCACCACAAGCCATTGCGGAGTTGGTAGGAAAACCATTTCACCAGATGGCAAGATCTGATACAGAATCTTTGGCAGGACTCACAAAACTTAATAATTCAAAGTCTGTTGCAAGTTTAAATAGAAGTCCTGAAAGGAGGAAACATGAATCAGACTCCTCATCTTTTGAAGACCCTGGTCAAGCATATGGTATAGGAATGACTTTGCATAGTTCTGGAAATTCTTCATCCCAAGTACCCTTAAAAGAAAATGATGTACTACATAAAAGATGGAGCATAGTATCTTCGCCAGAACGTGAGATCACCTTGGTGAACCTGAAAAAAGACGCAAAGTATGGTTTAGGATTTCAAATTATTGGTGGGGAGAAGATGGGAAGACTGGATCTAGGTGTATTCATTAGTTCAATTACCCCTGGAGGACCAGCTGATTTGCATGGATGCTTAAAGCCAGGAGACCGTTTGATATCTGTAAATAGTGTGAGTTTAGAGGGGGTCAGCCACCATGCTGCAATTGAAATTTTGCAAAATGCACCAGAAGATGTGACACTTGTTATCTCTCAGCCAAGAGAAAAGACATCCAAAGTGTCTCCTACTCCTGTGCACATTGCCAATGGCATGAAAAATTACATGAAGAAAGCTTCCTATATGCAAGACGGTGCAATAGATTCTTCTGAGGATCACCACCACTGGCCACATGGTACCCCGAGGCATATCTCAGAGAGCTCTTTTGGACTGTCTGGAGGCCTGCGGGAAGGAAGCCTGAGTTCTCAAGATTCCAGGACTGAGAGTGCCAGCTTGTCCCAGAGCCAGGTCAATGGTTTCTTTGCCAGCCATGTAGGTGATCGAACCTGGCAGGAATCACAGCACGGCAGCCCTTCCCTATCTGTGATATCCAAAGCCACCGAGAAAAAGAGGACTTCTAGTGACAGTAACCAAAACAAAGCTAAAAAAACAGGCATTTCTGATACAACAGATTATTCTGACCGCGGAGATTCAGACATGGATGAAGCCACTTATTCCAGCAGTCAGGATCATCATCAAACACCAAAAAAGGGAGGTGTGAATACGAGTGTCAGACATGGTGGCATTTACGTGAAAGCTGTTATTCCCAAGGGAGCAGCAGAATTCGATGGTAGAATTCACAAAGGTGATCGTGTCCTAGCTGTCAATGGAGTTAGTCTGGAAGGAGCTACCCATAAACAAGCTGTGGAAACACTGAGAAATACGGGACAGTTGGTTCATCTGCTGTTAGAAAAGGGACAGTCTCCAGCATCCAAAGAACATGTCCCTGTAATGCCACAGTGTGCCCTTCTGGATCTGAATGCCCAAGGTGAAGAAGGCCCAGAAAAAATGATGAAGAAAATGACATATGTCAAAGACTACAACTTTGTCACTGAAGAAAATACATTTGAGGTAAAATTGTTTAAAAATAGCTCAGGCCTAGGATTCAGTTTTTCTCGAGAAGATAATCTTATACCCGAGCAAATGAATGCCAGCATAGTAAGGGTTAAAAAGCTCTTTCCTGGACAGCCAGCAGCAGAAAGTGGAAAAATTGATGTGGGAGATGTTATCTTGAAAGTGAATGGAGCCTCTTTGAAAGGACTCTCTCAGCAGGAAGTTGTATCCACTCTCAGGGGAACATCTCCAGAAGTATCCTTGCTTCTCTGCAGACCTCCACCTGGTGTGCTCCCAGAAATCGACCCTGCTCTTTTGACCCCACTGCATTCTCCAGCACAAGTACTTCCAAACAGCAGTAAAGACCCTTCTCAACCAGCGTGTGTGGAGCAAGGCACCAGCTCAGATGAAAATGAAATGTCTGACAAAAGCAAGAAACAATGCACCTCCCCATTCAGGAGAGACAGTTATAGCGGCAGCAGTGGGAGTGGAGAAGAAGACTTAGTGAAAGCTCCAGCAAAGATAACAAATACAAGCTGGAGTTCAGCTTTGCATCAGTCTCTAAGCAACATGGTATCACAGGCACAAAATCAGCATGAGGCAACCAAGAGTCAAGATGATACCGTTTGCACCATGTTTTACTATCCTCAGAAAATACCTAATAAACTAGGACTCGAGGACAGTAATCCTTCTTCCCCTCTACCACCGGATGTGACTCCTAGGCAACCCCAAACAGAATCCACTTCCACTAATTCAGTGGATAAATATCATACACATCATATTTCTGAACCAACTAGACAAGAAAGCTTGACATCTTTGAAAAATGACTTGGAAAACCACCTCGAAGACTTTGAAATGGAAGTAGAACTCATCATTACCCTAATTAAATCAGAAAAAGGAAGCCTGGGTTTTACAGTAACCAAAGGCAATCAGAGTATTGGTTGTTATGTTCATGATGTCATTCAAGATCCAGCCAAAAGTGATGGAAGGCTAAAACCTGGGGACCGCCTCATAAAGGTTAATGATACAGATGTTACAAACATGACTCACACAGATGCAGTGAACCTGCTCCGAGCTGCACCCAAGACAGTCAGATTAGTCCTTGGACGAGTTCTAGAATTACCCAGGAAGCCAGTGCTGCCTCATTTGCTACCTGACATTACATTAACATGCAACAAGGAGTTGGGTTTTTCCTTGTCTGGAGGTCACGACAGCCTTCATCAAGTAGTGTATATTAGTGGTATCAATCCGAGGTCAGTTGCAGCCATTGAGGGTAATCTCCAGCTGTTAGACATCATCCACTATGTGAATGGAGTCAGCACACAAGGCATGACCTTGGAAGAAGCGAAGAGAGCACTAGACATGTCACTCCCATCAGTGGTGCTGAAAGCAACAAGAGATGGTCATCCAGTGGTCCCTAGTTCCAAGAGTTCTGCTGTTTCAACTCCAGAATCAACTAAAGCTAATGGTCATCACAATGTGGATCCTTGTGGCAAGCCTGCCCTCACTCCTAATAATTCCTTCTCCAAGGCTAATGGGGAAGAAATAATTGAAGTTTTGTACCCTGAAGGAAAATGCTCTACTCATCAAATGAAGGGATCAGCAAATTTGATTCTGTCCAAAGAATCTGATGTACAAGAAGATGATATTTATGATGATCCTCAAGAAGCCGAAGTTATCCAGTCTCTGCTGGATGTTGTGGATGAGGAAGCCCAGAATCTTTTAAACAAAAATAATGCAGCAGGAGATGCCTGTGTTCCAGGTGCACTGAAAACCAATGGGAAGTTATCTGAAGAGAGAGCAGAAGATACAGACTGTGATGGATCACCTTTACCTGAAGATTATACAGAGTCTACCAAAATGAATGGCTGTGAAGAATATTGTGAAGAAAAAGTAAAAAGAGAAAGCTTAACTCAAAAGTCACAAGAAAGGAAGACTGATGATTATGAAATAACATGGGGAAGTGACGAATTGCCAACAGAGACAACAAACCACGAAGATTCCATTAAAGATCATCCCCTTCTGACACATGAGGAGCTTGCTGCACTCCCCATCGTCAAAGTGCTTCCCTCTGGTAAATACACTGGTACCAAGTTGAAATCAGTCATTCGAATGATGCGGGGTTTACTGGATCAAGGAATTCCTTCTAAGGAGTTGGAGAATCTTCAAGATTTAAAACCTTTGGATCAGTGCCTAATTGGACAAACTAAGGAAAATAGAAGGAAAAACCGATATAAAAATATACTTCCCTACGATGCCACAAGAGTGCCTCTTGGAGATGAAGGTGGATATATCAATGCCAGCTTCATTAAGATACCAGTGGGGAAAGAAGAATTCATTTACATTGCCTGCCAAGGACCTCTCCCTACAACTGTTGGAGATTTCTGGCAGATGATTTGGGAACAAAAATCCACAGTGATAGCAATGATGACCCAAGAAGTAGAAGGGGAAAAAATAAAATGCCAGCGCTATTGGCCTAACATCCTAGGCAAAACGACAATGGTCAGCAACAGGCTTCGGCTGGCTCTCGTGAGAATGCAACAGCTAAAGGGCTTCGTAGTAAGGGCAATGACCCTAGAAGATATTCAAACAGGAGAGGTGCGACATATTTCTCATCTGAATTTCACTGCTTGGCCAGACCACGACACACCTTCTCAACCAGATGACTTGCTTACTTTTATCTCTTACATGAGACACATTCACAGATCGGGCCCAATTATCACACACTGCAGCGCTGGCATCGGACGTTCAGGGACCCTGATATGCATAGATGTGGTTCTAGGATTAATCGGTCAAGATCTTGAATTCGACATCTCTGATTTAGTTCGCTGCATGAGACTACAAAGACATGGAATGGTCCAGACGGAGGATCAATATATTTTCTGCTACCAAGTCATCCTTTATGTCCTGACACGTCTTCAAGCTGAAGAAGAGCGGAAAGAGCAGCCACAGCCTCTGAAATGACCTGAAAAGAACAGCCTTCTGGATGCCTTTCCCACTCTCTTCATAACCTCCAATAGTTGCTCCTGCTCTCCATTATAAAATAAGGATCCCAAGGCCATAAGTCCATACAATGTCTATACTTATTCTCCTCTACCTTAGAGGGGCATTCTTCATAACAACAAATAATGTTGAAATGCTGTATTTTTACAGCTGCTTTAACCTGTGACAATTGTTTTAAAATTTTTAACACAAAATAATGCAGATCTTAGGCACAAGTAAGGCAGCATTTGATTATAGTGGACATTGTTATAAGGATGCACTGAGTTTATTTTAAATGTACCAATCTTGTTTATAGCAAAATTCTTTTTCAGTATTTTAATAGTTATTTTATAGGGGATACAGTATTTAAGCTTTAAATGACAGTAGTTTGGGCATAGAAAAAAAGTAGCAAAGGTTTACTGTATCAATTTCTGATGTTTACTATATAGAATTTCCTGTAATATATTTATATACTTTTTCATGAAAATGGAGTGATCAGATATGTTTGTAACGGCATCATCTATGTTTGATATGCATCATCTCACTTTGTAAATAAAAAAACACCTTAAAACATGAACAAACCAAAAGTGTATGCA