Transcript asmbl_6734

Sequence
Transcript Sequence for observation asmbl_6734 of TGE0006500:
GAGTGTTGAAAGGGAGGGAGGAGGAGTTGGAGCTCTGCGTGGTGGAAAGTTACGTGAGGCGGAGACCCGAAGGTGCAGCGCCACAGCTCAGGGGGCGGTGTGTCTGGGAGAAGCCGCTGCCCCTTGTGTCCCGACCTGCGAGCGCTCCGGCAGGGAAAGGAACGACGCCCCCTCCTGCAACGCGGACTCCTTTGGTGGCCCCCTAGGAGGTGGAGGAATATGGCATCGAAGGCAGCCCCCTCCTGCCGTCTGGTCTTCTGCCTCTTGATCTCCGCTGCTGTCCTCAGGCCAGGCCTTGGATGGTATACTGTGAATTCAGCATATGGAGACACCATTGTTATGCCTTGCCGAGTCGATGTACCTCAGAATCTCATGTTTGGCAAATGGAAATATGAAAAGGCCGATGGCTCCCCAGTATTTATTGCCTTCAGATCCTCTACAAAGAAAAGTGTGCATTACGACGATGTACCAGAATACAAAGACAGATTGAGCCTCTCAGAAAACTACACTTTGTCTATCAGTAATGCAAGGATCAGTGATAAAAAGAGATTTGTGTGCATGCTAGTAACTGAGGACAACGTGTTTGAGGCGCCTACGATAGTCAAGGTGTTCAAGCAACCATCTAAACCGGAAATTGTAAGCAAAGCACCATTTCTTGAAACAGAGCAACTAAAAAAGTTGGGTGACTGTGTTTCGAAAGACAGTTATCCCCCTGGCAACATCACATGGTACAGGGGTGGAAAGGTGCTGCAATCCCTTGAAGGAGAGGTGGTCATAATTTTTACAAAGAAAATGGACCCAGTAACTCAGCTCTATACCATGACTTCATCTCTGGAGTACAAAACAACCAAGGCTGACATAAAAATGCCATTCACCTGCTCTGTGTCATATTATGGACCGTCTGGACAGAAAACAGTTCATTCTGAACAAGCAGTCTTTGATATTTACTATCCTACAGAGCAGGTGACAATTCAAGTGCTGCCACCAAAAAATGCCATCAAAGAAGGGGACAATATTACTCTTAAATGTTTGGGAAATGGTAACCCTCCTCCCGAGGAGTTTTTGTTTTACTTACCAGGACAGCCCGAAGGAATAAGAAGCTCAAATACTTATACACTGACAGATGTGAGGCGCAATGCAACAGGAGACTATAAATGCTCCCTGATAGACAAAAAAAGTATGATTGCGTCAACAACCATCACAGTTCACTATTTAGATTTGTCCTTAAATCCAAGTGGGGAAGTGACCAAGCAGATCGGCGATGCCCTGCCTGTGTCATGCACGATATCTGCTAGTAGGAACGCAACTGTGGTATGGATGAAAGATAACACCAGGCTTAAATCTAGCCCATCATTTTCTAGTCTTCACTACCAAGATGCTGGAAACTATGTCTGTGAAACTGCTCTGCAAGAGGTAGAAGGACTAAAGAAAAGAGAGTCATTGACTCTCATTGTAGAAGGAAAACCTCAAATCAAAATGACAAAGAAAACTGATCCCAGTGGACTGTCTAAAACCATAATCTGCCATGTGGAAGGATTTCCGAAGCCAGCTATACAGTGGACAATTACTGGTAGTGGAAGTGTCATAAACCAAACAGAGGAATCTCCTTATATCAATGGCAGGTATTATAGTAAAATTATCATTTCCCCTGAAGAGAATGTTACATTAACTTGCACAGCAGAAAACCAGCTGGAGAGAACAGTAAACTCCTTGAATGTCTCTGCTATAAGTATTCCAGAACACGATGAGGCAGACGAGATAAGTGATGAAAACAGAGAAAAGGTGAATGATCAAGCAAAGCTAATTGTGGGAATCGTCGTTGGCCTCCTCCTCGCTGCCCTTGTTGCTGGCGTCGTCTACTGGCTGTACATGAAGAAATCAAAGACTGCATCAAAACATGTAAACAAGGACCTTGGTAATCTGGAGGAAAATAAAAAGTTAGAAGAAAACAATCACAAAACAGAAGCCTAAGAGAGAAATTGTTCTAGTTGTTGTCCAGGTGAGCAGGCCACATGAGGTTTATAGAAATAAT