Transcript asmbl_12042

Sequence
Transcript Sequence for observation asmbl_12042 of TGE0003615:
ACGTGAAACAGTTGGTAAAACTGGTTCTGGGAAATCTTTCTGGGGAAGAAGCTCTACTTCTGATGTACTAGACATACACAAGTCTCCATTCTCTCATCAGACCTTTCTTAACAAAGGGCTTAGTAAATCTATGGGATTTCTGTCCATCAGAGATACACAAGATGAGGAAGACTATTTCAAGGACATTTCATCAGATAATAATTCTGGACATGAAGATTCTGAAAATACCTGCCCTCCTTACCAGTTCAAAACTAGTGGCCCAGAAAAAAAAGCTCTTCCTGGCTCCGATGTCCTATCCAAGAAGAAGATCTGGGCTTCATCCATGGACTTGCTTTGCACAGCTGACAGAGACTTCTCTTCTGGGGAGACCTGCAGATATCGACACTGTCTCCCTGAGGCAGTAGCAGTGCGGTCTTCAACTGCTCCTAGAAAAAAGGAAGCAAGATACTCAGATGGAAGCATAGCCTTGGATATCTTTGGCCCTCAGAAAATGGATCCTATATTTCACACACGAGAATTGCCCACCTCCTCAGCAATATCAAGTGCTTTGGACCGAATCCGAGAGAGACAAAAGAAACTTCAGGTTCTGAGAGAAGCCATGAATGTAGAAGAAACACCTCGAAGATACAAAACTTACCACGGTGATATCTTTAGTACCTCCAGCGAAAGTCCATCTATTATTTCCTCTGAATCAGATTTCAGACAAGTGAGAAAAAGTGAAGCTTCAAAGAGATTTGAATCCAACAGTGGCCTCCCAGGAGTGGATGAAACTCCAAGTCAAGGCCAGTCACACAGACCAAGCAGACAATATGAAACACCCCTTGAAGGCAACTTAGTTAATCAGGAGATCATGCTAAAACGGCAAGAAGAAGAAATGATGCAGCTCCAAGCCCGAATGGCCCTTAGACAGTCTCGGTTGAGCCTGTATCCGGGAGATACAATCAAAGCTTCCATGCTTGACATCACCAGGGATCCATTAAGAGAAATGGCCCTAGAGACAGCCATGACACAAAGAAAGCTGAGGAATTTCTTTGGCCCCGAGTTTGTGAAGATGACAATTGAACCATTTATATCTTTGGATCTGCCACGGTCTATCCTTACCAAGAAAGGGAAGAATGAGGATAATCGAAGAAAAGTAAACATAATGCTTCTGAATGGGCAAAGACTGGAACTGACTTGTGATACCAAAACTATATGTAAAGACGCGTTCGATATGGTTGTGGCCCATATTGGCTTAGTGGAACATCATCTGTTTGCTTTAGCTACCCTCAAAGATAATGAATATTTTTTTGTTGATCCTGATTTGAAATTAACCAAAGTGGCCCCAGAGGGATGGAAAGAGGAACCAAAGAAAAAGAACAAAGCCACTGTTAATTTTACTTTGTTTTTCCGAATTAAATTTTTCATGGATGATGTTAGTCTAATACAACATGCTCTGACCTGTCATCAGTATTATCTTCAGCTGCGAAAAGATATCTTGGAGGAGAGGATGCACTGTGATGATGAGACTTCTTTGTTGCTGGCATCCTTGGCTCTCCAGGCAGAGTATGGAGATTATCAACCTGAGGTTCATGGTGTGTCTTATTTTAGACTGGAGCATTATTTGCCTCCCAGAGTGATGGAGAAACTTGATTTATCATATATTAAAGAAGAGTTACCCAAATTGCATAATACCTATGTGGGAGCTTCTGAAAAAGAGACAGAGTTAGAATTTTTAAAGGTCTGCCAAAGGCTGACAGAATATGGAGTTCATTTTCACCGGGTGCACCCTGAGAAAAAGTCGCAAACTGGAATATTACTTGGAGTCTGTTCTAAAGGTGTCCTTGTGTTTGAGGTTCACAATGGAGTCCGCACACTGGTCCTTCGCTTTCCATGGAGGGAAACCAAGAAGATTTCTTTTTCGAAAAAGAAAATCACATTGCAGAATACATCAGATGGAATAAAACATGCCTTCCAGACAGAAAACAGTAAAGTATGCCAGTACCTGCTGCACCTCTGCTCCTCCCAGCATAAGTTCCAGCTGCAGATGAGAGCAAGACAGAGCAACCAAGATGCCCAGGATATTGATGTACTACATAAAAGATGGAGCATAGTATCTTCGCCAGAACGTGAGATCACCTTGGTGAACCTGAAAAAAGACGCAAAGTATGGTTTAGGATTTCAAATTATTGGTGGGGAGAAGATGGGAAGACTGGATCTAGGTGTATTCATTAGTTCAATTACCCCTGGAGGACCAGCTGATTTGCATGGATGCTTAAAGCCAGGAGACCGTTTGATATCTGTAAATAGTGTGAGTTTAGAGGGGGTCAGCCACCATGCTGCAATTGAAATTTTGCAAAATGCACCAGAAGATGTGACACTTGTTATCTCTCAGCCAAGAGAAAAGACATCCAAAGTGTCTCCTACTCCTGTGCACATTGCCAATGGCATGAAAAATTACATGAAGAAAGCTTCCTATATGCAAGACGGTGCAATAGATTCTTCTGAGGATCACCACCACTGGCCACATGGTACCCCGAGGCATATCTCAGAGAGCTCTTTTGGACTGTCTGGAGGCCTGCGGGAAGGAAGCCTGAGTTCTCAAGATTCCAGGACTGAGAGTGCCAGCTTGTCCCAGAGCCAGGTCAATGGTTTCTTTGCCAGCCATGTAGGTGATCGAACCTGGCAGGAATCACAGCACGGCAGCCCTTCCCTATCTGTGATATCCAAAGCCACCGAGAAAAAGAGGACTTCTAGTGACAGTAACCAAAACAAAGCTAAAAAAACAGGCATTTCTGATACAACAGATTATTCTGACCGCGGAGATTCAGACATGGATGAAGCCACTTATTCCAGCAGTCAGGATCATCATCAAACACC