Transcript asmbl_11971

Sequence
Transcript Sequence for observation asmbl_11971 of TGE0003613:
TTTTGCTTCAAAAAGGAAACACAAAAATTGCTCTATATGGCTTAGGATCCATTCCAGACGAACGGCTCTATCGAATGTTCCTTAATAAAAAAGTAACAATGCTGAGACCAAAAGAAGATGAGAACTCTTGGTTTAACTTATTCGTGATTCATCAGAACAGGAGTAGACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGAATTCATTGATCTTGTTATCTGGGGCCATGAACATGAGTGTAAAATAGCCCCAACCAAAAATGAACAACAACTCTTTTACGTATCACAACCTGGAAGTTCAGTGGTTACTTCTCTTTCTCCAGGAGAAGCTGTAAAGAAACATGTTGGTTTGCTGCGTATTAAAGGAAGGAAGATGAACATGCAGAAAATTCCTCTTCACACAGTACGGCAGTTTTTTATGGAGGATGTTATTCTGGCAGATCATCCAGATATTTTTAACCCAGATAATCCTAGAGTAACCCAAGCCATACAAAACTTCTGTTTGGAGAAGATTGAAGAGCTGCTTGAAAATGCTGAACGGGAACGTCTGGGAAATCCTCGACAGCCAGATAAGCCTCTTATACGACTGCGAGTGGACTATAGTGGAGGTTTTGAACCTTTCAATGTTCTTCGCTTTAACCAGAAATTTGTGGATCGAATAGCTAATCCAAAAGATGTTATCCATTTTTTCAGGCGTAGAGAACAGAAGGAAAACACAGGAGAAGAGATCAACTTTGGGAAATTCATTACAAGACCTTCAGAAGGAATGACTCTAAGGGTGGAAGACCTTGTAAAACAGTATTTTCAAACTGCAGAGAAGAATGTGCAGCTCTCACTTCTAACAGAAAGGGGAATGGGTGAAGCAGTACAAGAATTTGTGGACAAGGAAGAGAAAGATGCCATAGAGGAATTAGTGAAATACCAGTTGGAAAAAACACAGAGATTTCTTAAAGAACGTCATATTGATGCCCTAGAAGATAAAATTGATGAAGAGGTACGTCGTTTCAGAGAAAGCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTTCGAGAGGCCATGACTAGGGCCAGAGCCCTGAGATCTCAGTCAGAGGACTCCGCTTCTGCCTTTAGTGCTAATGACCTTATGAGTATAGATATGGCAGAACAGATGGCTGATGACTCGGATAGTAGCATTTCAGCAGCAGACAACAAAGGAAGAGGCCGAGGAAGGGGCCGAAGAGGAGGAAGAGGGCAGAATTCAGTGTCCAGAGGAGGATCTCAAAGAGGAAGAGCAGGCACCGGTGCAGAAACTTCTACTCGAAGCAGAAGTTCAAAGGCCACTATGTCAACATCTAGAAATATGTCTATTATAGATGCCTTTGGATCTGCGAGACAGCAGCCTTCTCAAAATGTTACTACTAAGAGTTATTCGGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTCAAAAACAGATCAAAGGTGGTCGAACACGTCATCATCATCAAGCAAATGCATGTCCCAGAGCCAAAAAAGTAAAGGGGTCAATTTTGAATCAGATGAGGATGATGATGATGATCCTTTTATGAACATTAGTTCTTTAAGAAGAAACAGAAGATGATATTTTTAATGGCATTTTGAAGTTTTCAAGATTCAGGAAAAATCAAAACGTTGCAAGCTAAGAGTTTACAATTGAAGATTTTTAAAGTATTGTTGTTAACCGAAGGATTTGAAAGAGACATATTTAACAGAGAGACTAATGTATAAGAATTTCTATTTTTAAGTATCATTTCCTGAATATGACACCATTACTTGAGAAACTTCCCGGCTCAAAGACATGTAAAATAGCATTGGTTTTCCTTATTTTTTGAATCTGGTTGTTAACATTACCTGACAATGCGGTATAAAATTTATACTGTTATTTTCCTGACATGTATTAGTGTGTGTCTTAGTCTGAGCTTTGTTTAGATATCATTCTTAAAGAAGGATTAAAATAAATATACCATTATACATTTCTGCTTCGCAAAGACTGTCAATATTTTAATGTAGTCACATTTAATCAAAGTTGAGAAAAAGGGCATATAAAATTTAACCTTTTTATAATTTTAATAATTTCTAGAGATTCTTGATTTCCTGAAGGTAAACCAGCTATGCCTAAGCTTGCTTTTTGTTA