Transcript asmbl_11805

Sequence
Transcript Sequence for observation asmbl_11805 of TGE0003611:
ACGTTAGTGTCCGCGCCATCAGGCCCTAGGTGTCGGCGAGTTACCTTCTTAGTGCATGGTTTTACCCGCCAAGAGATTCTGCTTGGTGCCAGCAATGGAGGGTGTGCGCTGGGCCTTTTCCTGCGGCACTTGGCTGCCGAGCCGAGCCGAATGGCTGCTGGCGGTGCGGTCGATCCAGCCCGAGGAGAAGGAGCGTATTGGCCAGTTCGTCTTTGCCCGGGACGCTAAGGCAGCCATGGCTGGTCGTCTGATGATAAGGAAATTAGTTGCAGAGAAGTTGCATATCCCTTGGAATAATATTCGTTTGCAAAGAACTGCAAAAGGAAAGCCAGTTCTTGCAAAAGACTCATTGAATCCTTACCCCAATTTCAACTTTAACATCTCTCATCA