Transcript asmbl_11765

Sequence
Transcript Sequence for observation asmbl_11765 of TGE0003610:
TTTGAATTCCCTAACCCAGAGGAGGCGAGGTCGACAGGGCAAAGGACTCAGGTGCAGGCTTCCCTAACGGACTAGTCTCGCACCTAAAGAAGAAAGAAAATGGCCTGTGCCGAGTATTCTTTTCATGTGCCGAGTCTAGAGGAGCTTGCTGGAGTTCTACAGAAGGGACTAAAGGATAACTTTGCTGACGTCCAGGTTTCTGTAGTTGATTGCCCTGATTTGACTAAAGAGCCATTTACCTTTCCTGTGAAAGGCATCTGTGGGAAAACTAGAATTGCAGAAGTAGGAGGTGTGCCTTACTTATTGCCTCTTGTAAATAGAAACAAAGTCTATGATCTAAATAAGATTGCAAAAGAAATCAAGCTTCCTGGAGCTTTTATTCTTGGAGCGGGGGCAGGCCCATTTCAGACTCTCGGGTTCAATGCTGAGTTTATGCCAATTGTTCAAACAGAAAGTGAACACAAACCTCCTGTGAATGGAAGTTACTTTGCCCGTGTTAACCCTGCAGATGGAGGATGCTTACTAGAGAAATACAGTGAGAAATATCGTGATTTTGGGTGTGCATTACTGGCTAATCTTTTTGCCAGTGAGGGCCAACATGGAAAGGTCATTGAGGTGAAAGCCAAAAGAAGAACTGGAAAACTTAACTTTGTGACTTGTATGAGACAGACTCTTGAAAAACATTATGGAGATAAGGCTGTAGGGATGGGAGGTACTTTCGTAATTCAGAAGGGAAAAGTGAAGACTCACATTATGCCTGCAGAATTTCCTTCCTGCCCTTTGAACTCTGAGGAAAAGGTGAATGAATGGTTGAATTTTTATGAGATGAAGGCTCCTTTGATTTGTCTGCCAGTTTTTGTCTCCAAAGACCCAGGATTTGATTTGCGATTGGAGCACACTCACTTTTTCAGTCATCATGGAGAAGGTGGACACTACCATTATGACATTACCCCAGATATAGTAGAATATCTTGGCTACTTCTTACCTGCGGAGTTTCTTTATCGCATTGATCAACCAGAAGAGACCCATTCATATGGGCGAGATTAAATCAACTGATCAGCATTTAGAAAAAGAAGTGATTAACTAAAGTTAATTAAATGATTAACTCATTAATTGCTACAAATATAAAGTTCAATAGAAATGATCTTACTACTTAAACCCTATTTTTTTGGCCTTTGAAATGAAAGGTATGTTGACATTACTCTGTTATTTCATAGATCTGAAAAAGTTTCTTGGGAACAAAGATATATAATGGAGATGTTCTTCATTATTTTTTTATTCTAAAAATCAGTCTTATATTTATACCTTAAATATAAACATGATCTGGAATCATGTGATTGGTTAATTTTACTAACAGTAATAATTTACACTTAACATTATTAATTTTTTCAAATTAGTCTCACAACTGCTAATTGGGTATTTCTGGGTACTAGAAAAATCAGTGTTGGAAATTTTGATAGTTGTTGAATCTTTGTATTGAATTTTAAAAGTCTATTTTAGGAGTCAGAGTACACTTTTTTCATGGAATAAGGTGATCAGAAGGAGCAACTTTACCCCTTTTGGTGAAGTTGAACCATACTCAGAGTTTGCAGTTTGCCTTGTACAAACATTAGCAACTAGACAGTTAGCCATGATTCCTCTTTTGTTTGGATCGCCAACTGGAAGCAGTTTGTACCTTATTAGTTATTTGGAAGAAGAAAGCGGGGAAAAGAAACAGCATCAAAATACAACACTGAAGTGAGTATAATTTCTAAGTGAGGCTGTTGTTACACATGACCACTGTCCTTTGTGAAATATAAAATTATATTTGAATACATTTGTTACTGGTTATAATGGTTGAAATTTTCTTCAGTGTTCTTCTGTAATAATCATTAGTAAGAAATCAACTGTAATCTTATTAATGCCAACAATGTGCAGATTTAGGAGCTCTTCAGTACTAAGCACATAATAAATCAAAAAATATTATTTGATTGTCTTCTCTGGATGTAAGCTATAACATATCCTTTGAGTATAAATTTTAAAATATTTTTAAATA