Transcript asmbl_65641

Sequence
Transcript Sequence for observation asmbl_65641 of TGE0006720:
AAGTGAGGTCCTTCGGTACTGAAGACCGTCCCACAGACAGGCCTGCGCCTCCGAGAGAGGAGATTTACGAGTACATCATTTTCCGGGGAAGTGACATCAAGGACATCACCGTGTGTGAGCCCCCGAAAGCTCAGCACACACTCCCTCAGGACCCCGCGATCGTCCAATCTTCCCTGGGCTCGGCCTCCTCCTTCCAGCCACACGTGCCTTACAGCCCCTTCAGAGGGATGCCGCCCTACAGCCAGCTGGCCGCCAGCTCCCTGCTTAGCCAGCAGTATGCAGCGTCCTTGGGTCTAGGTGAGTGATCTGTGTCTCTTTGGTAAACTGCCTGTGCTGGGACCGCTAGGAAGCAGGGCCACGGATCCTGATGGGGGTCACTGCTCTCGCCACGTTCAGCTCATAGGGCCCACTTAGTACGGTGCTCGGTGCAGCTTCCCTAGTTGGAACGTTTCACGACTGCTCGGCCGAGCGCACGAGAGGCAGCAGTCCGTTTCGGAGCAGACGCGTCAGCGTGCATCGAATGTCAGTCTGATCCTGGGTGACAGTGACGGTGCATCTGCTTGAGAGACGTAATGACTGACGGGTGTAATCACGGATGAGTTCTCGCTGCGTGCACCTTTTCCAGTCTCTAAGTATAAGTTAAATACACCACCCACGTGTCACGTCCTTTATCGTTCTGCTGGCAACGCTTCGCTTAACGGTTCAGTTTCCCCGGGTTGCTTAAGCTTGGAGTAAGGGTCCCCCACACCTGTGGGGGAGGGTCCGCCGGACCCGGCCCAAGCTTGCGATGCAGCCAGACCCCAAGCCCCGGGGTCGGGTCAGCAGGGACCAGCCACCTTGCTCCTCCAGGAGTGGGTGTGAGCGGGCCCTAGACAGTCCTCTGGGTCACCTGCCTCTGAAAATCGTGTCTTGCTTGCCGCCACTGCTGCTAGCATGGCAGCGCCCTCCGCCTGGCTTCCTGTTTCTGGAATGGGCTGGTGTGAGCGGAGTCCCGCGAGATGCCGGGCTCGTCCTGAGCCTGCGGGACGCGGGGCCGGTTCCTCGTTACTCATCCGCACTCTTTCTTTGTGCTCTTTCTCCTTTCTCCTCCTTTAGACAAGCTGGCCAGCCCGCCGGCCTCGGCCGCAGCCTCCAGCCCTAGCTCCTCTCCATCTCCACAGCCCGTTTCAGAGCCCGACCTGTGCTCAGAGCCACACCAGCTCGCTTCCAAGGGAGCTGGTTTTCCATCTGCCCCCGTCGGCAAGAGCCCCATGGTGGAGCAGGCTGTCCAGACCGGTTCCCTCGATAACCTGAATGCCAGGAAGCCGTCGCCCGGCAAGGGCACAGTGGGGATGCAGCTCAACGGGCGCCCGACCCCGCCAGGCAGCAAGAGCGCCAGCGATGTAGCCCAGCCGGCCACAGTGCAAACCCAAGGGCAGGTGAACGACGAAAACAGAAGGCCCCAGAGGAGGAGATCAGGGAATAGACGAACCAGGAATCGCTCCAGGGGGCAAAGCCGCCCAACTCACGTCAAGGAGAATACCATCAAGTTCGAAGGCGACTTTGATTTTGAGAGTGCAAACGCCCAGTTCAACCGTGAGGAGCTGGACAAGGAGTTTAAGAAGAAACTGAATTTTAAAGATGACAAAGTGGAGAAAGGGGAGGAGAAGGACCCGACACTGGTGACCCAGAGTGACGAGGTGCCAGCCGAGGAGGACCACCTGGGGCCCAACTGCTACTACGACAAGTCCAAGTCCTTCTTCGACAATATCTCCTCTGAACTCAAGACCAGTTCCAGGAGGACCACATGGGCCGAGGAGAGGAAGCTCAACACGGAGACCTTCGGGGTGTCGGGAAGGTTTCTCCGTGGCCGCGGTTTCCGGGGCGGATTGCGAGGGGGCAGGGGCACCGGTACGACCCGGCGCAACCCTACTTCCCACCGAGCTGGGACGGGCAGAGTGTGAGGGGGCAGCCAGAGGCTCCTGCCGAAGCAGCGGAGACGAATCTGTGAGGGCCACGGAGGACGCCGCATTTACGGGAGACGCTGGGCCCCTCTGTTTACTGTTTGCAGAATTCCCACGTGCTACTTTTGTTCTGGACTTCACGCGACTTGGACGTGGTCTGAGTTGGAACCACTTGTTTTGGGGAAGTGTTTATGGGAAGCCTCTCCGGGGCATCAAGATCTTTTGTTCTTACTTGCACACAGTGTAATCTAAGGTTTTGGTATTTTGCAAAGAGGTTTCTAGAACGAAAGCTCGATTCTCATTTCGTGACTTTTTTTTGGCCGCTTTGACTTTGAAAGTGGAACCAAATCTCCTTGGGCAGTGTGGCAGCCGGGCGCGGCTCTGTAATCCAGCTGGCCCCTGGTGTTGCTGGCCTGGCACCCCCGTGCCAGGTGGGGTCTCAGGAGCCAGGCAGGGCCAGCACAGGGGTGAGGG