Transcript asmbl_65609

Sequence
Transcript Sequence for observation asmbl_65609 of TGE0006717:
CTGGCTTTCTCTTTTTTTCCTTTTAGTTTTGGGATACGCGATCATCAAATCCTATGATGGTTTTGCAACTCCCTGAAAGGTGTTACTGTGCCGACGTGATATATCCTATGGCCGTGGTGGCCACTGCAGAGAGAGGACTGATTGTCTATCAATTAGAGAACCAACCTTCTGAATTCAGGAGGATAGAATCCCCACTGAAACACCAGCATCGATGTGTGGCTATTTTTAAAGACAAACAGAACAAGCCGACTGGTTTTGCCTTGGGAAGTATCGAGGGGAGAGTTGCTATCCACTACATCAACCCCCCGAATCCAGCCAAAGATAACTTTACCTTTAAATGTCATCGATCTAACGGAACCAATACTTCAGCTCCTCAGGATATCTACGCGGTCAATGGAATCGCGTTCCATCCTGTTCATGGTACACTTGCCACGGTGGGATCTGATGGCAGATTCAGCTTTTGGGACAAAGACGCCAGAACAAAACTTAAAACTTCAGAACAGTTAGATCAACCGATATCGGCTTGCTGCTTCAATCACAATGGAAACATATTCGCATATGCTTCCAGCTACGACTGGTCAAAGGGACATGAATTTTATAATCCCCAAAAGAAAAATTACATTTTCCTGCGTAACGCAGCCGAAGAGCTGAAGCCCAGGAACAAGAAGTAGGGGAGCCTCCTGGCTGCCACAGCGCCTTCCTCTCCACTCTGCCTCGTCTCACGAACTTGGGTCCCAGCTTTTTGTGGGTTCAGCCATGGATGTGGATTCCAACCCTCGGGGAAAACTGTCATTGTTTGGCAGTCGGGCCCAGCGGGCCACAGTGACCGTTGGTCTCTCCATTCCACTGCCCATTACAGACGTCTCTGGAACTGTGAGGGGGTTGGAGTCGCTGTAGAAGTTAGGTCCCTGCGGGCGACTGCCAGGCATTCGCAGTCTTCGCTCAGCAGCGTGTGTATAGAGAACACTGGGAATCATTTTGTGAACCCTGGACTGTATTTTGTAATAAAGCATTTCGAAGATTGTCTCCTAAGCTCACTGTGTCCACCTTGCCCGCCCG