Transcript asmbl_65587

Sequence
Transcript Sequence for observation asmbl_65587 of TGE0006711:
GGCGGGAGCCGAGGCTTGCAGCGGGACTCCCCGCTGAGAGCGCGACGCGGCCTTGAGCGGCAGACGGCGCAGTAGGCCGAGGGGGAGGCGCGGCAGCCGCCCTGGCCCGTCATGGAGATGGAAAAGGAGTTCGAGCAGATCGACAAAGCCGGGAGCTGGGCGGCCATTTACCAGGATATCCGACACGAAGCCAGTGACTTCCCGTGTAGAGTGGCCAAGCTTCCCAAGAACAAAAACCGAAACAGGTACAGAGATGTCAGTCCCTTTGACCATAGTCGGATTAAACTTCATCAAGAAGATAACGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGAAGTTACATTCTTACCCAGGGCCCTTTGCCTAATACGTGCGGCCACTTCTGGGAGATGGTATGGGAGCAGAAGAGCAGGGGCGTGGTCATGCTCAACCGAGTGATGGAGAAAGGATCGTTAAAATGTGCGCAGTACTGGCCACAAAAAGAAGAAAAAGAAATGGTCTTTGAAGACACAAATTTGAAATTAACATTGGTCTCCGAAGATATTAAGTCATATTATACAGTACGACAACTAGAATTGGAAAACCTTTCATCTAAAGAAACTCGAGAGATCTTACATTTCCACTATACCACGTGGCCTGACTTTGGAGTCCCCGAATCTCCAGCCTCTTTCCTGAACTTTCTTTTCAAAGTCCGCGAGTCGGGGTCACTCAGCCGGGAGCATGGCCCCATCGTGGTACACTGCAGCGCTGGCATCGGCAGGTCGGGGACCTTCTGTCTGGCCGACACCTGTCTCTTGCTGATGGACAAGAGGAAAGACCCTTCTTCTGTCGATATCAAGAAAGTCCTGTTAGAAATGAGGAAATTTCGAATGGGACTGATCCAGACAGCAGACCAGCTCCGTTTCTCCTACCTAGCTGTGATCGAAGGTGCCAAATTCATCATGGGAGACTCTTCAGTGCAGGAGCAATGGAAGGAGCTCTCCCACGAGGACCTGGAGCCCCCACCTGAGCATGTCCCCCCACCTCCCCGGCCACCCAAACGAATCCTGGAGCCACACAATGGGAAATGCAAGGAATTCTTTCCAAACCACCAGTGGGTAAAGGATGAGTCTGAGGAAGATAAAGAAGATGGCCCCATCAAGGAAGAAACCATAACACCCTTAAGTGTCCCCTGCATGGAACGCACGAGTCAAGACACTGAAGTCAGAAGGCGGGTCGTGGGGGCAGGTCCTGCTCAGGGGGAGCCGTCGCCACCCAAGGAGGAGCAGGACCAGGCTCTGACTCACTGGAAGCCCTTCCTGGTCAACATGTGCATGGCCACGGTCCTCACAGCTGGCGCGTACCTCTGCTACAGGGTATGTTTTCACTGACGGACGTGCCGGCAAGACCACGTGTACAGAAAGCACTGGCCGACAGCCTGGCGGTAGCATTCAGTGCTGTGCAAGGATCTGAGCCAGTCTCAGAAGAAACAGATCAAAGTTTTTTAAAGTCTGGAACTGTGAAGGGCTAACAAGAGAGAATTGAGGATTGATGCACTGGGGTTTTAAGGAGCCCTGTGGTCCCAAGAATACAACAGTCTAATCTCAGGGCCTTAACCTATTCAGGAGTAAGTAGAGAAAATGCCAAATACATCTCTCTCTCTTCATTTTTCTTTCTTTCTTTTTCTTTGTTTTTTTTTGTTTGTTTGTT