Transcript asmbl_65383

Sequence
Transcript Sequence for observation asmbl_65383 of TGE0006675:
CGTGAGGTCATCGCGCGGGCGGGCGGGGTCGGGCGGTTTGAACGAGACGAAGACGAAACCGGAGCCGGGCACGGGCAGTGGACGCGGTTCCGCTGAGAGCCGAAGATGGCAGTGAACGTATATTCAACATCAGTTACCAGTGATAATCTAAGTCGACATGACATGCTGGCCTGGATCAATGAGTCTCTGCAGTTGAATTTGACAAAGATAGAACAGTTGTGCTCAGGGGCTGCCTATTGTCAGTTTATGGACATGCTGTTCCCTGGCTCCATTGCCTTGAAGAAAGTGAAATTCCAAGCTAAGCTAGAACATGAATACATCCAGAACTTCAAAATACTACAAGCAGGTTTTAAGAGGATGGGTGTCGACAAAATAATTCCTGTGGACAAATTAGTAAAAGGAAAGTTTCAGGACAATTTTGAATTCGTTCAGTGGTTCAAGAAGTTTTTTGATGCAAACTATGATGGAAAAGACTATGACCCTGTAGCTGCCAGACAAGGTCAAGAAACTGCAGTGGCTCCCTCCCTTGTTGCTCCAGCTCTGAACAAACCGAAGAAACCTCTCAGCTCTAGCAGTGCAGCTCCACAGAGGCCCATTGCAACACACAGAACTACTGCAACCCCTAAGGCTGGCCCGGGTGTGGTGCGAAAGAATCCTGGTGTGGGCAATGGGGATGACGAAGCAGCCGAACTGATGCAACAGGTCAACGTATTGAAACTTACCGTTGAAGACTTGGAGAAAGAGAGAGACTTCTACTTTGGAAAGCTAAGGAACATTGAATTGATTTGCCAGGAGAATGAGGGGGAAAACAACCCTGTATTGCAGAGGATTGTGGACATTCTCTATGCCACAGATGAAGGCTTTGTGATACCTGACGAAGGGGGTCCACAGGAGGAACAAGAAGAGTATTAACAGCCTGGACCAGCAGAGGAACGTTGGAATTTTTCACTCCAAATCATGTGCTTAACTGTAAAATACTCCCTTTTATTATTCTTAGAAGACTCACTGGTTTCTTTTCATAAGCAAAAAGTACCTCTTCTTAAAGTGCACTTTGCAGAAGTTTCACTCCTTTTCCAATAAGTTTGAGTTAGGAGCTTTTTACCTTGTAGCAGAGCAGTATTAACATCTAGTTGGTTCACCTAGGGAACAAAGAGGCTGACCATGGGGCTCACCGAATGGATACTGGTAACACTGATTACTGGAGAAGGTGTTTTTATGTGATATGCTGAGGTGGAGACCTCAGAGAAAATGTAAAGACTGATTTGAATTTTAAGCTAATGTGAAATCTTGGCAGAGAACGTTTTAATAAATAAATGCCTTAAGAGTATTTAAAATATGCTTCCATATTTCAAAATATAAAATGTAACCTGACGGGATTTTGTGTGTTCAACCTTGTGTCTGGAAAGGAAGGGCCAGACCTTGGAACCTTTGGAACCTGCTGTTCACAGGCCTTGCAGGGCAGCTTGAATCTTCACAGGCCTAACCTTGGCCCAGAAGGGAAGTTTAAAATGTTGCTCTGTAAAGCCGTGTGGTGTCCTTGATCAATTGCATCTCTGCTAGGAAGCAAGAGGCGTTGCCTGAATGAATAAGAGTATGTTTTAGTCCTGAGATGTTTGAGTTGAATAGCTCGATTTTCATTGAGCATTTCTCTGACGATTTTTCCAATTACCCCTGAAATTTCTATGTATTGTGTTTATTTTTGGGAAATGAGGTGTGTTCAGTTTTTAAATCTAACAACTACTTTTTGGGACTTGCCCACATCTCTGGGATTTGAATGGGGGTTGTGTCCCATTTTACTGTTTTTTTAAGTTTACATTTAACATATTTCTCTTCTCTGCTCCCCTTGCCCACTGGGGACTCCTCTTTGGCTCCTTAAAGTTTGCTGCTTAGAGTGGAAGTTGAACAGGCAGGTGATCATGCTGCAAGTTCTTTCTGGACCTCTGGCAAAGGGAGTGACCAGTGAAGGCCATCGCTACCATGGGATCTGCAAGGCTGGGTGTTTTTGGTACCTGCTGTCCACAGCCTTCCACTGTTATCGGAATACTTTGCCAGTGCACTAATCTCTTTGGAGATAAAATTCGTTAGTGTGTTACTAAATGTTAATTTTCTTTTGCAGAAAATACAGTGCCATGTCTGAATTAATTATTAATATTTAAAATATTTCATTCCTTAACACTCCCTCATTTGCTTTGCCCACAGCCTATTCAGTTCCTTTGGCAGAATTCTGCAAAATGTGTGTCACCCACTACTGAGATTGTTCAGCCCCTGATGTATTTGTATTGATTTGTTTCTGGTGGTAGCTTGTCCTAAAATGTGTGTAGAAAGCCGGTATTTTATGATAAATTGTTGTGTAGTGCATGCTCTGTGTGGAATTCAGAGGAAAACCCAGATTCAGTGATTAACAATGCCAAAAATGCAAGTAACTAGCCATTGTTCAAATAACAGTGGTGCTATTTCTCTTTCGTGGCCTTTTAGACTTTTGTTGCCCTAAAATTCCATTTTATTGGGAACCATTTTCCACCTAGTCTTTCTTGACAGG