Transcript asmbl_63885

Sequence
Transcript Sequence for observation asmbl_63885 of TGE0006627:
CTTCATTAGTTTTGTTGGGATATTGTAAGCTAAATTTCTTTGTGACTTGAGAAGGCCAAGAGACTGAAGTCCTCCATTTTTTCACAGAACAGGTAGAACATGGACAACAGCAATTCATCTTTTCCCCACACTGTGCCCTGCCAGTGTTCCTGGATCCTGACCCCCGGGGGCCCACCTCTGGGGTGAGAGGGTGGCTCATTCATTCAGTCCTTGGCCATTCTGAAACTGCCAACAAGGGTGGAAGTTTGGGGAAGTGGACTCCAGGTCACTAAGAATGGAATTGAGCGTACTTAATGAAATCTCAAATACTCATTCTGAAAGAGTAAATCATACCTGCCTGGAGTGAAGAAAGCTTTGGGCAAATATGGCCCTGCTAATGTGGAAGACACCACTGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGATCTCTTTGGATCTGATGATGAAGAGGAGAGCGAAGAAGCAAAGAGGCTAAGAGAAGAGCGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAAGCCTGCACTTGTTGCCAAGTCTTCCATCTTATTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCTAAATTGGAGGAGTGCGTCAGGAGCATTCAAGCAGATGGCTTGGTCTGGGGCTCTTCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAGATACAGTGTGTAGTAGAAGACGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTCAACAAGATCTGAAATCCATCATGGATCATTACTCTTAAATAAAAGCTTGAAAGACA