Transcript asmbl_63884

Sequence
Transcript Sequence for observation asmbl_63884 of TGE0006627:
CTTCATTAGTTTTGTTGGGATATTGTAAGCTAAATTTCTTTGTGACTTGAGAAGGCCAAGAGACTGAAGTCCTCCATTTTTTCACAGAACAGGTAGAACATGGACAACAGCAATTCATCTTTTCCCCACACTGTGCCCTGCCAGTGTTCCTGGATCCTGACCCCCGGGGGCCCACCTCTGGGGTGAGAGGGTGGCTCATTCATTCAGTCCTTGGCCATTCTGAAACTGCCAACAAGGGTGGAAGTTTGGGGAAGTGGACTCCAGGTCACTAAGAATGGAATTGAGCGTACTTAATGAAATCTCAAATACTCATTCTGAAAGAGTAAATCATAGTGAGTATTGAATATAATGTGTCACGTACTGCTAATGTTTGTTGGGTGAGAAGTTAAACGTATAAAAGTACTTCCCTGAGAGTGTTAAAACGATCTATTGATAGCGATGAAAATAAGTTCTCATGTATTGCCTGAAAAAGGATGTTATACCAACCTAATAGTTAAATTTAAATGTTTTTTCAAGCCTGCCTGGAGTGAAGAAAGCTTTGGGCAAATATGGCCCTGCTAATGTGGAAGACACCACTGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGATCTCTTTGGATCTGATGATGAAGAGGAGAGCGAAGAAGCAAAGAGGCTAAGAGAAGAGCGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAAGCCTGCACTTGTTGCCAAGTCTTCCATCTTATTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCTAAATTGGAGGAGTGCGTCAGGAGCATTCAAGCAGATGGCTTGGTCTGGGGCTCTTCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAGATACAGTGTGTAGTAGAAGACGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTCAACAAGATCTGAAATCCATCATGGATCATTACTCTTAAATAAAAGCTTGAAAGACA