Transcript asmbl_63882

Sequence
Transcript Sequence for observation asmbl_63882 of TGE0006627:
CTCTTTTTTTCCTCTTAACGTTCAGCGAGAACTGCAAACGATCCTGTTTCCTCCGCTGCTGCCCAGTTGCCGGACCAGCAAACGCCATGGGTTTTGGAGACCTGAAAAGCCCCGCTGGCCTCCAGGTGCTCAACGACTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTACCATCACAAGCAGATGTAGCAGTATTTGAAGCAGTCTCTGGCCCACCACCTGCCGACTTGTACCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCTGGAGTGAAGAAAGCTTTGGGCAAATATGGCCCTGCTAATGTGGAAGACACCACTGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGATCTCTTTGGATCTGATGATGAAGAGGTATGGCATAAATTGATGAGAGCGAAGAAGCAAAGAGGCTAAGAGAAGAGCGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAAGCCTGCACTTGTTGCCAAGTCTTCCATCTTATTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCTAAATTGGAGGAGTGCGTCAGGAGCATTCAAGCAGATGGCTTGGTCTGGGGCTCTTCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAGATACAGTGTGTAGTAGAAGACGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTCAACAAGATCTGAAATCCATCATGGATCATTACTCTTAAATAAAAGCTTGAAAGACA