Transcript asmbl_63811

Sequence
Transcript Sequence for observation asmbl_63811 of TGE0001320:
CCTCCTCCTCCTCCTCCTCCTCGCGTTAGTTCCGGTCGCAGAGGAGAGACCGCCGCAGTTGTCGCCACATCGCGGATTTCTGGCTCTTTTCTCTTCGCCTTAAATTCGGGTGTCTTTTATGAATAATCAAAAGCAGCAAAAGCCAACGCTATCAGGCCAGCGTTTTAAAACCAGAAAAAGAGATGAAAAAGAGAGGTTTGACCCTACTCAGTTTCAAGACTGTATTATTCAAGGCTTAACTGAAACTGGTACTGATTTGGAAGCAGTAGCAAAGTTTCTCGATGCTTCTGGGGCAAAACTTGATTACCGCCGATATGCAGAAACACTCTTTGACATTCTGGTGGCCGGCGGAATGTTGGCCCCAGGTGGTACACTGGCAGATGACATGATGCGTACAGATGTCTGTGTATTCGCAGCACAAGAAGACCTAGAGACCATGCAAGCATTTGCTCAGGTTTTTAACAAGTTAATCAGGCGTTATAAATACCTGGAGAAAGGTTTTGAAGATGAAGTGAAAAAGCTGTTGCTGTTTCTAAAGGGTTTTTCGGAGTCAGAGAGGAACAAGCTGGCTATGTTGACTGGTGTTCTTCTGGCTAATGGAACACTTAATGCGTCCATTCTTAATAGCCTTTACAATGAGAATTTGGTGAAAGAAGGAGTTTCAGCAGCTTTTGCTGTAAAGCTCTTTAAATCATGGATAAATGAAAAAGATATCAATGCAGTAGCTGCAAGTCTTCGGAAAGTCAGCATGGATAACAGATTAATGGAACTTTTTCCTGCCAATAAACAAAGCGTTGAACACTTCACAAAGTATTTTACTGAGGCAGGCTTGAAAGAGCTTTCAGAATATGTTCGGAATCAACAAACCATAGGAGCTCGTAAAGAACTCCAGAAAGAACTTCAAGAACAGATGTCCCGTGGTGATCCATTTAAGGATATAATTTTGTATGTCAAGGAGGAGATGAAAAAAAACAACATCCCAGAACCCGTTGTCATTGGAATAGTTTGGTCCAGTGTAATGAGCACGGTAGAATGGAACAAAAAAGAGGAGCTTGTAGCAGAGCAAGCCATCAAGCACTTGAAGCAATACAGCCCTCTACTTGCTGCCTTTACTACTCAAGGTCAGTCTGAACTGACTCTGTTACTGAAGATTCAGGAGTATTGCTATGATAACATTCATTTCATGAAAGCCTTCCAGAAAATAGTGGTGCTTTTTTATAAAGCTGAAGTCCTGAGTGAAGAACCCATTCTGAAGTGGTATAAAGATGCACATGTTGCAAAGGGGAAAAGTGTCTTCCTTGAGCAAATGAAAAAGTTTGTTGAGTGGCTCAAAAATGCTGAAGAAGAATCTGAGTCTGAAGCTGAAGAAGGTGACTGAATTTTGAAACTACACCCTCAGTAAAGCAAACAGGGAGTTGTAGATAAAATGTCATGTCTCATGTGTCCTGGTTCTTACATCTTCCTACCTCCCTATATCAAGCATGATATAAGGGCTTTCATGGCAAATTTTATTTTAACTGTTTCTATGGTTACTGGATATGTTGGGTTTAGTTTCTAAAACCATGTTTTAAGTAGCTACAGGAGCTATAGATTTGAATCTAATGTTGCATTAGTTTTTTCAGTTATCTTCTACCTCCTGTATTTTCTACTGTAATAATGTAATTTAAGGCCTTCCACAATGAACAGTTCACTTTTTCCCTGGGTTTTCTATATAAACAGTTTTCAAGATATGATTTGGTTAAAAATAATTTGTTATAAGAATTTTGTTTGCAAATTAAACTGTAAAAGTATCCAAAGTCTCAAAAGGCAATGATTTGTGTGATAATTTGGTATGCCCAAAGCCCTCCTCATCAATGACAGTCTCATACAGTGATTGAATTCATTAACATGAATCTTGAGTATTTGAACCATTGCTTACATATTAATATTTTCTTGCATTTTTAACCCCAGATGTCCTCGAGTTCAGTTGTTTGCTCTCTGGTTTTCATTCCTTGGTAAAGCCATGGAGAACAATCTTGAAAGTGAGGTCTCTGGGAAATTGTATGTGGCAGATGTGATAGGAAGAAGAAAGTTGAGCTTTTTCCCATTGAGAAACTTCTGCATTCAGTTTGTGTCTTTCCAGGAAAAGCAAATGGGTATTTTTTTCATACCGTTTTCAACTGTACCTTAAAAAGTTTTGTCATTTAACGAATTTAACACTTGTCATATGTTTAGATAGGAAAGGACTCATGAAATAGTGAATAAAGAAAATGACTGTTGAAATGTTAAGTGATCAGCATGGTCTAATTGGGAACTCTTAAATATAACTCATTTCCTGTGGGTTAAGCGTATTTGATGTAAAGAATGGAGTGTAATAATGATATATTCCCACTTGGTCATATAAGACCAGCTTCATTCTTGTAACATTAACAAATGATTCAAGCATCTGACTATTAACATGCCCTAGTT