Transcript asmbl_11387

Sequence
Transcript Sequence for observation asmbl_11387 of TGE0003598:
GGTAGGGCGGGGCGCGGCCGAGGTCCCCAGACCAGAACTGGAGAGGATATTCGGGATCCCTACTCCGCTAGTGGAGAAAGGACCTGCCTCCCACGCACCCTCACCTAACCAGAGCGGGGATTTCTATGGCCCCTCCTGCTGGCTTTTTGAAGAAAGCGAAAGTGAAAGAGGGAAGAAGACTGAGGAGATCGCGGCGCCATGAAGCACCTGTCCCTGCTCCTCGCTCTGGCTTTGGGCTTGGTGACCGCCGTCTCGGCGGGACCCACGGTGATAGAATGCTGGTTCGTGGAGGATGCAGACGGGGGCCGCCTGGCCAAGAAACCCGCTGCATTGCTGCTGCGCCAGGGCCCAGGGAGAATACCTCCCCGGCCGGACCTCGACCCCAAGCGCTACCTCAGAGTACATGACCCCACAGGCACCCTGCAGGCTGCCTTCAGGCGGTACCCCCGGAGCGCCCCCACGCCACACTGCGAGATGAGCCATTACATCCCACTCCCCGCCTCTGTGAATTGGGTCAAAGGCCTGACTCCGGAGCAGAGCTGCCCGCGGGCCTTGGACGGGACTTGGTTCATGGTCAGCATGTCCAGCCCGGTCCTCAGCCTCTCCAGCCTCCTACAATCACAGACCGAGCCTCAGCCAGATCCTGGACTCATCACCATGGCAACAGCTGTGCTGACTGTCATCACCCACAACCCCACCACTAGAATCCAGCTGGGACAAGATGCTCTGCTGGACTTGAGCTTTGCTTACATGCCCTCCACCCCAGAGGCCACTACACCTCTGGCCCCAGGTCCCCCTCCCTTTGGGCTGGAGTGGCGACACCAGCACCTAGGGGAGGGGCACCTGCTCCTGGCTGCAACTCCTGGGCTGCGTGGGCAAATGCCAGCTGCCCGAGATGGGGCAGTGGCATTTGCCGCTTGGGATGATGATGAGTCATGGGGTCCATGGACTGGAAATGGGACCCTCTGGCTGCCTGCAGTGAAGCCTTCCCAGGAGGGTGCCTATCAGGCCACCATATACCTGCCATATCTGCAAGGACAGGTCACCCTGGAGCTTGCTGTGCAGAAATCCCCCAAAGTGTCCCTGATGCCATCACCTCTTGTATGGGCTGCCCCTGGGGAGGCACCCCCTGAGCTAGTTTGCCTTGTGTCCCACTTCTACCCCTCTGAGGGCCTGGAGGTGGAGTGGGAGCTCCGAGGTGGTCCAGAGGGGAGCTTTCAGAAGGCCAAGGGGCAGAGTTGGCTCTCAGCCCTGCACCACCACTTGGATGGCTCTGTCAGCCTCTCTGGGCACCTGCAGCCATCCCCGGTCACCACTGCACAGCACGGGGCGCGCTATGCCTGTCGTGTCCACCACCCCAGCCTACCCGCATTGGGGCGCAGTGCTGAAGTCACCCTGGAGGTGGCAGGTCTCTCTGGCCCCTCCCTGGAGGATGGTATAGGCCTCTTCCTGTCTGCTTTTCTGCTCTTGGGGCTCTTCAAGGTACTGGGCTGGGCAGCTGCCTACCTGTCCACTTCCAAGGAATCAAAGAAGAAAGCACAGTGAGGGCACTCAAGACCACCCTGGGGAAGCTACCATCATCTCTGACCTGAACTACTGTAGTAGCTCCTCCAAACAGTATGCCATCACCTGCTCCTGCTCCTGCTCCTTCCAATCTCTCTCCACGGTGGGAATGCTTTTTTAAAAAAGACACAAATCTATAGCATTCACCTTCTTAGAGCTCTAAGGCTGTGGTTCTCAAAATTTTTGGTCTCAGGACATCATAAAAACGAAGGACTCTCGAGCTTTTGTTTATGTGGGTTATAAACTAACTATTTATCATACTAGAACTTAAAACTGAGAAAAGTTTAAAACAGAAGGATACACAGGCACACATTCCATTGGCTGTGAAGGAGATAATGTCAATACACATCATGTAGCTCTGGGAAATTTCACTGTACATTTTTTTAGAGAATGAAAGTGAAAAAGGCAAATAACATTTTAGTGTTATGAAAATAGTCTTAACTTCGTATGCGCAGTGAATTAGTCTCAGAGATCTCTGGGGCAGGGACCACACCAAGAGAACGGGTGCTCTAGAGGCCAAATCCATTCTTCTTGCCCTTGGCACATGAATTTACGGCGCTGGAGCCACTGCTTACCTCTTCAACCCAATCTGGTGCTCTCCAGCACTCTCAATACTCATCACACCTACAGCTCTTCCTTTCCTCCAATGGCCTCTCACCTTCCCTAGGTCCCAGAGTTCTGTTCTCTCTGCCTGGTCCACCCTCGCTCTCCCTGGGCTCCAGACCAGATCAGCCAAGTCATTCCCCTCAGACCGCCGCGTGTCCCTCTTGTGCGGTTCACCACGGTTGTACTTAAGTGATTGTGCGAGTTGTTAAAGCCCGTTTCCCGGACTCTCAGCTCCTCGCAGTTGCAAAAACAAGTCTGTATGTCCACTGCTTTATCTCCCGCATCGGCAGTGGGCCTGGCGCCCACTGGAGGGCGCTCGGTATAAGAAGTTATAGTCCTTTTTTTCATCCTAAGGATTCAAAAACAGGTATAGGGTCAAGTAACTACTGGACGAAGGAAGCGGCGACTTAAGGACCTCCGAGGGGCAGGACCGTGGGCCAGACCGACGCGGGGAGCGAGTCTACTCGGTGGGAATAAAGTTGTGTTCCAGTGCT