Transcript asmbl_63771

Sequence
Transcript Sequence for observation asmbl_63771 of TGE0013670:
CTAAACTTATAGAAAACCGCCAATATTTAAAATTTTAAACAAAGCTATATAGCAAGGAGTGAATAATGCTGAAAAATTTGACTATGTGATGCAGTTTTTGAATAAGATGGCTGGTAATGAATATGTTGGATTCAGTAATGCAACGTTTCAGTCTGAAAGAGAAAGTGGAGATCGAAATTTTGCAATAGGATATTACTTAAAAGAAAAAAAGTGTTTTCCAGAAGGTACAGATATGGTTGGTATATTAGACTTCTATTTCCAGCTGTGCTCCATTGAAGTAACTTGTGAATCAGCTAGTGTGATGGCTGCAACACTGGCTAATGGCGGTTTCTGTCCAATTACTGGTGAAAGAGTGCTGAGCCCTGAAGCAGTTCGAAATACACTGAGTTTGATGCATTCCTGTGGCATGTATGATTTCTCGGGGCAGTTTGCTTTCCACGTTGGTCTTCCTGCAAAATCTGGAGTTGCTGGGGGCATTCTTTTAGTTGTACCCAATGTCATGGGCATGATGTGCTGGTCTCCCCCTCTGGACAAGATGGGCAACAGTGTTAAGGGAATTCACTTCTGTCATGATCTTGTTTCTCTGTGTAATTTCCATAACTATGATAATTTGAGACACTTTGCAAAAAAACTTGATCCTCGTAGAGAAGGTGGTGATCAAAGGCATTCCTTTGGACCATTGGACTATGAAAGTCTCCAACAAGAACTTGCTTTAAAAGAGACAGTATGGAAAAAAGTGTCACCTGAGTCAAATGAGGACATCTCTACAACTGTAGTATATAGAATGGAAAGTCTGGGAGAGAAAAGCTAAAAGAAATGAGTTCTAGTTTCAGAACATTCTTCATTTAACCTTTCGAACACCTTTAGCTTTTTTGCATACTATATATATTTATTTGAGTGTTTGTGTTCTTAACCTTGGGTGCTTGAGCCATAAAGCTATTTTTTTTCTTTTAATCTTTGTGTAAAGATAATAGATTAAAAAGTGGAATTGCCAGGTT