Transcript asmbl_63743

Sequence
Transcript Sequence for observation asmbl_63743 of TGE0006607:
TTGAAAATTGAGAAAGTCCGGAGCTAGGAGTAATTGCAGCCGCGATGGCAGCCTTTGCTGTGGAACCCCAGGCGCCCACGCTGGGATCTGAACCAATGATGCTGGGTTCACCCACATCTCCAAAGCCAGGGGTTAATGCCCAGTTCCTACCTGGATTTTTAATGGGGGATTTGCCAGCTCCAGTGACTCCACAACCTCGAACAATTAGTGGCCCTTCAGTAGGAGTAATGGAAATGAGATCACCTTTGCTTGCAGGTGGGTCACCACCACAACCAGTTGTACCAGCTCATAAAGACAAAAGCGGAGCTCCACCAGTTAGAAGTATATATGATGACATTTCCAGTCCAGGACTTGGATCAACACCTTTAACTTCAAGAAGACAGCCAAACATGTCATTAATGCAGAGTCCTCTTGTTGGAGTTACGACAACTACTCCTGGGATAGGGCAAAGTATGTTTAGTCCAGCAAACATTGGACAACCACGAAAGACAACGTTATCTCCTGCCCAGTTGGATCCTTTTTATACTCAAGGAGATTCTCTGACTTCTGAAGATCACCTCGATGACACATGGGTGACTGTGTTTGGGTTTCCTCAAGCATCTGCTTCCTATATATTATTACAATTTGCACAATATGGGAATATCTTAAAACATGTGATGTCTAACACAGGAAATTGGATGCATATTCGTTATCAATCTAAACTGCAGGCTCGGAAGGCCTTAAGCAAAGATGGGAGGATTTTTGGAGAGTCCATCATGATTGGTGTAAAACCATGTATAGATAAAAGTGTTATGGAAAACAGTGACAGGTGTGCTTTGTCATCCTCACCTCTGGCCTTTACACCACCAATCAAAACCCTAGGTACACCAACCCAATCTGGAAGTACTCCTAGGATTTCTACCATGAGACCTCTTGCTACAGCATACAAAGCTTCTACTAGTGACTATCAGGTCATTTCTGACAGACAAACGCCGAAAAAAGATGAAAGTCTTGTATCCAAAGCAATGGAGTACATGTTCGGCTGGTAGTGTAATAACAGCTAAGAACTGAACTACAAAGGAGGAGGCTGCTACACTAAAACAGTTAGCAGAGTACTGCCAGG