Transcript asmbl_63742

Sequence
Transcript Sequence for observation asmbl_63742 of TGE0025539:
TTGAAAATTGAGAAAGTCCGGAGCTAGGAGTAATTGCAGCCGCGATGGCAGCCTTTGCTGTGGAACCCCAGGCGCCCACGCTGGGATCTGAACCAATGATGCTGGGTTCACCCACATCTCCAAAGCCAGGGGTTAATGCCCAGTTCCTACCTGGATTTTTAATGGGGGATTTGCCAGCTCCAGTGACTCCACAACCTCGAACAATTAGTGGCCCTTCAGTAGGAGTAATGGAAATGAGATCACCTTTGCTTGCAGGTGGGTCACCACCACAACCAGTTGTACCAGCTCATAAAGACAAAAGCGGAGCTCCACCAGTTAGAAGTATATATGATGACATTTCCAGTCCAGGACTTGGATCAACACCTTTAACTTCAAGAAGACAGCCAAACATGTCATTAATGCAGAGTCCTCTTGTTGGAGTTACGACAACTACTCCTGGGATAGGGCAAAGTATGTTTAGTCCAGCAAACATTGGACAACCACGAAAGACAACGTTATCTCCTGCCCAGTTGGATCCTTTTTATACTCAAGGAGATTCTCTGACTTCTGAAGATCACCTCGATGACACATGGGTGACTGTGTTTGGGTTTCCTCAAGCATCTGCTTCCTATATATTATTACAATTTGCACAATATGGGAATATCTTAAAACATGTGAAACAACTTCATTCTTAACAGATGTC