Transcript asmbl_11372

Sequence
Transcript Sequence for observation asmbl_11372 of TGE0003597:
GGGGGCGGCGGCAGTGGCAGCATTGGGGACGGCAGCCGTGAAGGCGACGGTGGCGCAGGGCCGGGGACGGGGGGAATGAGGAGGCCGCGGCGGGCCAGCGGCGGAGCTGTGTAGCGGATAAGCGGCTCCCCCTCCTTCCCTTGGTTGAGTCGGGGGCGCGCGCGCGAGCGCGCGGCCGTCCGGAACGGGCTTCCCACCCTCCACTCCCGCGACCCGCACGGCACCCCCACCCGGGCCCGGAGGATGATGAAGCTCAAGTCGAACCAGACCCGCACTTATGACGGCGACGGCTACAAGAAGCGGGCCGCGTGCTTGTGTTTTCGCAGCGAGAGCGAGGAGGAGGTGCTACTTGTGAGCAGTAGTCGCCATCCCGACCGATGGATTGTCCCTGGAGGAGGAATGGAGCCAGAGGAGGAGCCAAGTGTGGCAGCAGTCCGTGAAGTCTGTGAGGAGGCTGGAGTAAAGGGGACATTGGGAAGATTAGTCGGGATTTTTGAGAACCAGGAAAGGAAGCACAGAACATATGTCTATGTGCTCATTGTCACGGAAGTGCTGGAAGACTGGGAAGATTCAGTTAACATTGGAAGGAAGAGGGAGTGGTTTAAAATAGAAGATGCCATAAAAGTGCTGCAGTATCACAAACCGGTGCAGGCGTCGTATTTTGAAACATTGAGGCAAGGCTACTCAGCCAACAATGGCACCCCGGTCGTGACCACCACATACTCAGTTTCTGCTCAGAGCTCTATGCCAGGCATCAGATGACTGAAGACTTCCTGTAAGAGAAATGGAAATTGGAAATTAGACTGAAGTGCAGATCTTCCCTCTCACTCTTGCTCTTTTCACCTCTCTTCACAGGCCTCCTCTTTCAAATAAGGCATGACGGGCAGCAGAGGAAGGGTTTATTGATAATGTTCCTGTTTGGTGTTAAGTGATGGGGCTTTTTCTTCTCGTTTTTTTTTGAGGGGGGTGGGGGTTGGGTATGTAATTTGTAAGTACTTTTGTGCATGATCTGTCCCTCCCTTTTCATACCTCTACAATTCTCTAAAAAGAGGCAGACAGCCTTCCCTTTGCCTTGGATTCTGAAGTATTCCTCTTTGTCTCATCCCATCCCTGGCCAGACATTTTTCTTTGATTTTTAATTTTTTTAAATTAAAAGCTACCAATATGAGATAAAAACTTTCAAGAATTTGTTCTGTAATGTGCTGTTCAGTCCAGTAGGTTGGTCAGTTTCACTGCAGAATACATTTATCTACACATTATATACTGGGCATATAATATGTAAATAAATGACTTTTAGAAGAAAAATTTAACAGTTTAAATTTTTTTCAAGGTTTTGTTTTGTTTTTTAAATTTGGGGTGTTTCTGAAATGGAGAGCCTCACAATTTACTTTTTAATTTTTCCTGCTAGTGTCTAGATAAGTCTTCCTGTCCTTTCTCTTTTCCCCAGTCATTGATGTAGTTATGTAAGGTAAGGGAAGAGTTTAGCTACCTTCCTAGTGCTCCCAGGACTCATAGCCTTCTCTTCGCAAGCTGTGTTTCCATGCCAAGAAAGAAACAGGAAGAAACCTATTTGCTTTTTTATTACCAAGCCAGGAGCAAATGGCCTCAGCTCAGATTTGGAGAAACAGTGATAGCAATTGAATTCCTCCCTTGTATGTTGACAATAGGGATTTGAACTGGATTCTTGGGATTACTATCTAAAAAACTGGAGCATCAAGCACTGTTTCTATCCTGCTAGTTTGGAATTTTTTCCATAATGCTACTTACTACCGACAACAGCCTCTCTCCTGTGCATACATGCCTTACAGTGTGCCGAACTAGATATTGTCCTTGTGCTCTGAAGCATCCAGGTGCATCTGTACAGTCCTGTCCCCATCCTGGGTAACCTTGTTAAGTTCCTGAAAAGTACACAGGAGGAAAGTTCAGGTGTTTGCTGATCTTCGTAATGTTATATAGCTCTTGTAATTGCACCATGGAGCATGCTCAGAAATACTGAATTTGTCTCCCACTGGGATGTGAAAGGTCCATCTTCTGCTGAGAAGTGATATGGGAGAAGCTTAATCATTTACTAGAACAGCTACATAATGCATTAGCTCACTGCAAACTGTCTTGTTGGTTTTTAGTACAGGTTTCATGTTGGTTTCATTTGCCAATTGAGTTGTTTAGTTGAGAAGTAAGTAGAAAAGGGTCTTGAGATCTGGGGCTGTGACTGGGAGTGGAGGAGACACTGATCATTCCCTGGCTTGGGACAGGAGTTTGTTGCTGTACTCTTAGTGGCATCTCCTTTGTCAAAACATAGCCAAGATGTGAAATTAGAATCGTAGTTCTCCTTATTTAAAAATTCTAATAAATACTCAAATTTTGAAAAGCTTTTG