Transcript asmbl_63692

Sequence
Transcript Sequence for observation asmbl_63692 of TGE0006588:
CGCCCATCCCTCTTTGTGTGTTTCGGGAAGCCGCAGAGCTAGTGGCGGTGACTCTTGGCATTGGGGGTGAAGGAAAGGGACGTTACAGGGAACTTGCAGGCGGCAGGACTCTTCTCCATCCCGCCACTTGACAGGTGGGTTGGCTGTACTTCCTTCAAGGCCCTCCTGTCTACGGTGTCTCACGTCGGGACTCAAAGGGCGGCTTAAGAATTCCTGCATACGTTGCCGCCTGGCCTGGTTCCGGGCACGAGAGTCGGAGAGAGCCAGGTCACAAACATGTCAGACAAAAGTGAATTAAAGGCAGAGTTGGAACGGAAGAAGCAGCGGTTGGCCCAAATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAGGAAACTGATCAGAAGAAAGAAGCAGTTGCTCCTGTACAAGAAGAATCAGATCTCGAAAAAAAAAGAAGAGAAGCTGAAGCACTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTGTCCCTCCTCCTATGTCTCCATCCTCCAAATCTGTGAGCACACCAAGTGAAGCTGGGAGCCAAGACTCTGGAGATGGCGCAGTGGGATCTAGACGAGGACCTATTAAACTTGGAATGGCTAAAATTACACAAGTTGACTTTCCTCCTCGAGAAATCGTGACATATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCCAAAGAAGATGAAGAAGAAGAAGATGATGTGGTGACTACTAAACCACCTATTGAACCTGAAGAAGAGAAGACTTTAAAGAAAGATGAGGAAAATGACAGTAAAGCTCCCCCTCATGAGCTGACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAAGAATTTTTAAGTTTCTTTGACCATTCTACACGAATTGTAGAAAGGGCTCTTTCTGAGCAGATAAACATCTTCTTTGACTACAGTGGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAATCGACAATTTTTTGATGAACGTTGGTCAAAGCATCGGGTTGTTAGTTGTTTGGATTGGTCATCTCAGTATCCAGAGTTACTCGTGGCTTCATATAATAACAATGAAGATGCTCCTCATGAGCCTGATGGTGTGGCCCTTGTATGGAATATGAAATATAAAAAAACTACCCCGGAGTATGTGTTTCACTGCCAGTCAGCTGTGATGTCTGCTACATTTGCAAAATTTCATCCAAATTTGGTTGTCGGTGGTACATACTCAGGCCAAATTGTGCTGTGGGATAACCGTAGCAATAAAAGAACTCCAGTGCAAAGAACTCCACTGTCAGCTGCTGCACACACACATCCTGTATATTGTGTAAATGTTGTTGGAACGCAAAATGCTCATAATCTGATTAGCATCTCTACTGATGGAAAAATTTGTTCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAATTGGTTCATAAACAGTCAAAGGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTTGTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGTCGCCATGGCAGCAAAGCTGGAATCAGTGAGATGTTTGAGGGACACCAAGGACCAATCACTGGCATCCATTGTCATGCAGCCGTTGGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCATTTGACTGGACAGTAAAACTTTGGACAACTAAGAATAACAAGCCTTTATACTCATTTGAAGATAATTCAGACTACGTTTATGATGTTATGTGGTCACCCACCCACCCAGCCCTCTTTGCCTGTGTGGATGGCATGGGGAGGCTAGATTTGTGGAATCTCAATAACGACACGGAGGTGCCAACTGCCAGCATTTCCGTGGAGGGTAATCCTGCTCTTAATCGTGTAAGATGGACCCATTCTGGAAGAGAGATTGCCGTGGGTGATTCTGAAGGACAGATTGTTATATATGATGTGGGAGAGCAAATTGCTGTCCCCCGAAATGATGAATGGGCACGGTTCGGCCGAACACTTGCAGAAATTAATGCAAATCGAGCTGATGCAGAGGAGGAGGCTGCTACCCGAATACCTGCGTAGCTCCTGAAAATGGGATATGTAGCCTTAGTGGATTTGGGGAAGACTTTAAGTAGATCCTGAGACTATTTGCATGCTTCTGTCTAAATGATAATTAAAAGGAACTTTGGTGGATTAAACCATGGATTTAATGCAGCAAGCAATTCTTACAATGTCCCTTTTTATATAACATGCATCCTGTTTTGGATTTATGTCATTTTTAATACAGCTTATCGACTTTACTGAATGCAGCCTCTTTTGAATTCTTATACACAGGTGTATATTTGGTATTAGTTATTATTTTGAATTATTTTCAACTTATAACACTATATACAGTTATTTCTAAAGCACAAATTAAATAACTTCTGCATATTTTTAAGTAATCATAATTCCCTGTTATACTGATAAAGTTCTAACTTAATATGTGGGAACATTGTTCATTCTTAGCCATAGCATGCATACATCTATCCAAGTTATGTTCTAATATCTTTTTTCTTCTTTATAATTCATGTGATAGCTGTATATAAATAAAAACAAATATGATTTAACTTTTCA