Transcript asmbl_63691

Sequence
Transcript Sequence for observation asmbl_63691 of TGE0006588:
CGCCCATCCCTCTTTGTGTGTTTCGGGAAGCCGCAGAGCTAGTGGCGGTGACTCTTGGCATTGGGGGTGAAGGAAAGGGACGTTACAGGGAACTTGCAGGCGGCAGGACTCTTCTCCATCCCGCCACTTGACAGGTCACAAACATGTCAGACAAAAGTGAATTAAAGGCAGAGTTGGAACGGAAGAAGCAGCGGTTGGCCCAAATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAGGAAACTGATCAGAAGAAAGAAGCAGTTGCTCCTGTACAAGAAGAATCAGATCTCGAAAAAAAAAGAAGAGAAGCTGAAGCACTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTGTCCCTCCTCCTATGTCTCCATCCTCCAAATCTGTGAGCACACCAAGTGAAGCTGGGAGCCAAGACTCTGGAGATGGCGCAGTGGGATCTAGACGAGGACCTATTAAACTTGGAATGGCTAAAATTACACAAGTTGACTTTCCTCCTCGAGAAATCGTGACATATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCCAAAGAAGATGAAGAAGAAGAAGATGATGTGGTGACTACTAAACCACCTATTGAACCTGAAGAAGAGAAGACTTTAAAGAAAGATGAGGAAAATGACAGTAAAGCTCCCCCTCATGAGCTGACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAAGAATTTTTAAGTTTCTTTGACCATTCTACACGAATTGTAGAAAGGGCTCTTTCTGAGCAGATAAACATCTTCTTTGACTACAGTGGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAATCGACAATTTTTTGATGAACGTTGGTCAAAGCATCGGGTTGTTAGTTGTTTGGATTGGTCATCTCAGTATCCAGAGTTACTCGTGGCTTCATATAATAACAATGAAGATGCTCCTCATGAGCCTGATGGTGTGGCCCTTGTATGGAATATGAAATATAAAAAAACTACCCCGGAGTATGTGTTTCACTGCCAGTCAGCTGTGATGTCTGCTACATTTGCAAAATTTCATCCAAATTTGGTTGTCGGTGGTACATACTCAGGCCAAATTGTGCTGTGGGATAACCGTAGCAATAAAAGAACTCCAGTGCAAAGAACTCCACTGTCAGCTGCTGCACACACACATCCTGTATATTGTGTAAATGTTGTTGGAACGCAAAATGCTCATAATCTGATTAGCATCTCTACTGATGGAAAAATTTGTTCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAATTGGTTCATAAACAGTCAAAGGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTTGTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGTCGCCATGGCAGCAAAGCTGGAATCAGTGAGATGTTTGAGGGACACCAAGGACCAATCACTGGCATCCATTGTCATGCAGCCGTTGGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCATTTGACTGGACAGTAAAACTTTGGACAACTAAGAATAACAAGCCTTTATACTCATTTGAAGATAATTCAGACTACGTTTATGATGTTATGTGGTCACCCACCCACCCAGCCCTCTTTGCCTGTGTGGATGGCATGGGGAGGCTAGATTTGTGGAATCTCAATAACGACACGGAGGTGCCAACTGCCAGCATTTCCGTGGAGGGTAATCCTGCTCTTAATCGTGTAAGATGGACCCATTCTGGAAGAGAGATTGCCGTGGGTGATTCTGAAGGACAGATTGTTATATATGATGTGGGAGAGCAAATTGCTGTCCCCCGAAATGATGAATGGGCACGGTTCGGCCGAACACTTGCAGAAATTAATGCAAATCGAGCTGATGCAGAGGAGGAGGCTGCTACCCGAATACCTGCGTAGCTCCTGAAAATGGGATATGTAGCCTTAGTGGATTTGGGGAAGACTTTAAGTAGATCCTGAGACTATTTGCATGCTTCTGTCTAAATGATAATTAAAAGGAACTTTGGTGGATTAAACCATGGATTTAATGCAGCAAGCAATTCTTACAATGTCCCTTTTTATATAACATGCATCCTGTTTTGGATTTATGTCATTTTTAATACAGCTTATCGACTTTACTGAATGCAGCCTCTTTTGAATTCTTATACACAGGTGTATATTTGGTATTAGTTATTATTTTGAATTATTTTCAACTTATAACACTATATACAGTTATTTCTAAAGCACAAATTAAATAACTTCTGCATATTTTTAAGTAATCATAATTCCCTGTTATACTGATAAAGTTCTAACTTAATATGTGGGAACATTGTTCATTCTTAGCCATAGCATGCATACATCTATCCAAGTTATGTTCTAATATCTTTTTTCTTCTTTATAATTCATGTGATAGCTGTATATAAATAAAAACAAATATGATTTAACTTTTCA