Transcript asmbl_63528

Sequence
Transcript Sequence for observation asmbl_63528 of TGE0006559:
GGGAAAAGGAAAACCCTGCCCTGCGAGTGTGGGTCAATGCGTTTTTGCGGAGGAGGTGTTGGACTGCTAGGGCCCCGCTGAGATTGTCAGTTTGCGCGCTTTTGAGTTTAAGCGTGTGTGGCTGTGGCGACCCCCAGCGCGTCGCCAGCGTACCTTCCTCTGCAGGAGATAAACTGCACTCAGCTGAGTGCAAGATTAAGAGGAATTGATTAGAAGTTGACTCTAAAGGTTTATTGCAGTCAAAATGTCTCAAAAAATCCGTGGTGGTTCTGTGGTAGAGATGCAAGGAGATGAAATGACACGAATCATTTGGGAGTTGATTAAAGAAAAACTCATTTTTCCATATGTGGAATTGGACCTGCACAGCTATGATTTAGGCATAGAGAATCGTGATGCCACCAATGACCAGGTCACCAAGGATGCTGCAGAAGCTATAAAGAAGTACAATGTTGGTGTCAAGTGTGCTACCATCACCCCCGATGAGAAGAGGGTTGAGGAGTTCAAGCTGAAACAAATGTGGAAGTCACCAAATGGCACCATTCGAAATATTCTGGGTGGCACTGTCTTCAGGGAAGCTATTATCTGCAAAAATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCCATCATCATAGGTCGTCACGCTTATGGGGATCAATACAGAGCAACTGATTTTGTTGTTCCTGGTCCTGGAAAAGTAGAGATAACCTACACACCAAGCGATGGATCCCAAAAAAAGACGTACCTGGTTCATAACTTTGAAGAGGGTGGTGGTGTTGCCATGGGGATGTACAATCAAGATAAGTCAATCGAAGAATTTGCACACAGTTCTTTCCAGATGGCTCTGTCTAAGAGTTGGCCTTTATATCTGAGCACCAAGAACACTATTCTGAAGAAATATGATGGACGTTTTAAAGACATCTTTCAGAAGATATATGACAAACAGTACAAATCCCAATTTGAAGCCCAGAAGATCTGGTATGAGCATAGGCTCATCGATGACATGGTGGCCCAAGCTATGAAATCAGAGGGAGGTTTTATTTGGGCCTGCAAAAACTATGATGGTGATGTGCAGTCAGACTCCGTGGCCCAAGGTTATGGCTCTCTTGGCATGATGACCAGCGTGCTGATTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCATGGGACTGTAACACGCCACTACCGCATGTACCAGAAGGGACAAGAGACATCCACCAATCCTATTGCCTCCATTTTTGCATGGACCAGAGGGTTAGCCCATAGAGCTAAGCTTGATAACAATAAGGAGCTTGGCTTTTTTGCAAAGGCTTTGGAGGAAGTCTGTATTGAGACCATCGAGGCTGGCTTCATGACCAAGGATTTGGCTGCTTGTATTAAAGGTTTACCCAATGTGAAACGTTCAGACTACTTGAATACATTTGAGTTCATGGACAAACTCGGAGAAAACTTGAAGACAAAACTAGCTCAGGCTAAACTTTAAGGTCATTCCTTGACTTGGGAGGACACGTGTTTTTTTGGTAATTAGGTCCACTGGTTTACATTTTTCTGTATAACACTCAAGAGTATGGGCAAAATCAATTTTCTAATTTGTTTAGAAGTCAGAGTTTATCTTTTCTATAAGATTACAGTCTTTTTCTTATACATACAATTATGCCACCTTCATGAATGTGGCTGGGAACTTTTTAAAATTTTATTTTCTATTAGTAGCTTAGGAATTACTTTAGTGCTGATTTGTACTCACTGTCACTTTTTCTCATGTTCCAGTATAAATGACCAAAATGAAGAGTGCTCGAAAGGGTAAACTATAGCCATGGTATTAGTCCCTAAAATTGTATAAAGTAGAAATTCGCTCCCTTCCCCACTTTTCCATGGCCTGGGGCTCTGGGTGGTTTTGCTGTAACAGGTGTCCCATCCTGTGTGGTAGAGCTGTACCTTAAAAGTTGCCCATGAGTTGGAATGAAGAGCATGGTTATAACTAAGACACAGCAGTCATATATGTAAAGAGCTCTGATTGAACGTTTCGAAAAGGCTAAAGATTTTTGAAGCCACTAAGAGTGTTTGGAATCTAGAATAAATACTACTCGGGGGTTTGTCCTCTGCGTTTGTCTCCTCCTCCTGGCCCTGTGTGGCTTAAGTATTATACTGCCCTGAACAGCATATTTCATCTAAGTGCAATAATACAAGCTGCACCTTTTTTGTACTTCTGCTGGCCTGTTGGGTTTTTTTTTTATATAAATGTGACTTTTTAGAAATTTGTTTTAAACACTATACTAGTCTGTTCTTCATCTAAACTATTAATTAAAGTTAAGTGCTAA